ID: 1153915007

View in Genome Browser
Species Human (GRCh38)
Location 18:9737590-9737612
Sequence CATTTCTGCAGAAGAGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153915007_1153915011 21 Left 1153915007 18:9737590-9737612 CCTGCGGCTCTTCTGCAGAAATG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1153915011 18:9737634-9737656 GTGTTTATTATTCTGGTCATGGG 0: 1
1: 0
2: 4
3: 18
4: 270
1153915007_1153915009 14 Left 1153915007 18:9737590-9737612 CCTGCGGCTCTTCTGCAGAAATG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1153915009 18:9737627-9737649 ATTGCTTGTGTTTATTATTCTGG 0: 1
1: 0
2: 2
3: 21
4: 518
1153915007_1153915010 20 Left 1153915007 18:9737590-9737612 CCTGCGGCTCTTCTGCAGAAATG 0: 1
1: 0
2: 0
3: 10
4: 132
Right 1153915010 18:9737633-9737655 TGTGTTTATTATTCTGGTCATGG 0: 1
1: 0
2: 1
3: 35
4: 335

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153915007 Original CRISPR CATTTCTGCAGAAGAGCCGC AGG (reversed) Intronic
900143682 1:1149134-1149156 AATTTCTGCAGAAGAGTTGCAGG - Intergenic
901390594 1:8943452-8943474 CAGTTCTGCAGAGGGGCTGCTGG + Intergenic
901718737 1:11177910-11177932 CATTTATGCAGAATATGCGCAGG - Intronic
903738615 1:25545198-25545220 CATTCCTGGAGAAAACCCGCAGG - Intronic
904080339 1:27868664-27868686 CATTTCTGCAGGAGACCTGTGGG + Intergenic
904363923 1:29998665-29998687 CCTTTCAGCAGAAGAGGCACAGG + Intergenic
904595929 1:31645254-31645276 AGTTTCCGCAGATGAGCCGCGGG + Intergenic
905402897 1:37716284-37716306 TGTTTCTGCAGAAGGGCCCCTGG - Exonic
906480151 1:46194339-46194361 CTTTGCTGCAGAAGCGCCGGCGG + Exonic
911429559 1:97766891-97766913 CATTTCTTCAGAAGTGGCCCAGG + Intronic
912024935 1:105158170-105158192 CATTTCTGCTGGGGAGCCTCAGG - Intergenic
912800120 1:112715068-112715090 CCTTTCTGCAGCTGAGCCCCGGG - Exonic
913659285 1:120992394-120992416 CATCTCTACAGAAGAGCCTCAGG - Intergenic
914010648 1:143775518-143775540 CATCTCTACAGAAGAGCCTCAGG - Intergenic
914167178 1:145185597-145185619 CTTCTCTACAGAAGAGCCTCAGG + Intergenic
914340713 1:146757708-146757730 CATTTCTGCAGAAGGCCGCCTGG + Intergenic
914649271 1:149684175-149684197 CATCTCTACAGAAGAGCCTCAGG - Intergenic
916091893 1:161314159-161314181 GATTTCGGCAGAAACGCCGCTGG - Intergenic
916115936 1:161485115-161485137 CATTTCTGCTCAGGAGCCCCAGG - Intergenic
916716868 1:167454268-167454290 TACTTCTGCAGAGGAGCCACGGG + Intronic
917186305 1:172360555-172360577 CATTTGAGCAGTAGAGCCTCAGG + Intronic
920545529 1:206813471-206813493 AATCTCTGCAGAAGAGACACTGG - Intronic
923954220 1:238996159-238996181 TATCTCTGCAGTAGAGCCCCAGG + Intergenic
1066454252 10:35559613-35559635 CATCTCAGCAGAAGCGCTGCCGG + Intronic
1071170673 10:82859989-82860011 CAGCTCTGCAGCAGAGCTGCTGG + Intronic
1071776845 10:88798540-88798562 CATTTCTTCTGCAGAGCCGTTGG - Intergenic
1074280304 10:112045234-112045256 CATTTCTGAAGCAGACCCTCTGG - Intergenic
1075479805 10:122770069-122770091 CATTGCTGCATAAGTGCTGCTGG - Intergenic
1078145676 11:8720510-8720532 CATTGCTGGAGAAGAGAGGCTGG - Intronic
1080701668 11:34649546-34649568 CATCTCTGCAGAAGCTCCCCAGG - Intronic
1081588965 11:44407676-44407698 GCTTTCTGCAGGAGAGCCACAGG - Intergenic
1082944311 11:58741530-58741552 CATTTTTTCAAAAGAGCCCCAGG - Intergenic
1083572153 11:63766605-63766627 CCTTTCTGGACAAGAGCCGTAGG + Intronic
1084501859 11:69539876-69539898 CAGTTCTGCAGAGGAGCCTGGGG - Intergenic
1085220865 11:74872757-74872779 CATTACTGCACAGGAGCCCCAGG + Intronic
1089946002 11:122474267-122474289 CATATCTACAGAAGATCCACTGG - Intergenic
1093307556 12:17539191-17539213 CATATCTCCAGAGGAGCCTCAGG - Intergenic
1094131717 12:27081974-27081996 CATTTCCGGAGGGGAGCCGCTGG + Exonic
1098843102 12:75501423-75501445 CATTTCTACAGAAGATGCACTGG + Exonic
1100125017 12:91414095-91414117 CTTCTCTGAAGAAGAGCCCCAGG - Intergenic
1102083389 12:110116316-110116338 CATCACTGCAAAAGAGCCCCGGG - Intergenic
1102466546 12:113133895-113133917 CCCTTCTCCAGAAGAGCAGCAGG + Intronic
1104400862 12:128475070-128475092 CAATTCTGCAGAAGGGCTGTGGG + Intronic
1104629070 12:130384624-130384646 CATGTTTCCAGAAGAGCTGCTGG + Intergenic
1104633176 12:130422032-130422054 CCTGTCTGCAGAAGACACGCTGG - Intronic
1106418001 13:29561846-29561868 TGTGTCTGCAGAACAGCCGCTGG - Intronic
1107622807 13:42250673-42250695 ACTTTCTGCTGAAGTGCCGCAGG - Intronic
1117446341 14:55807038-55807060 AATTTCTACAGGAGAGCCTCAGG - Intergenic
1117755684 14:58971884-58971906 CATTTCTGCAGTAGAGACCATGG - Intergenic
1118719081 14:68580910-68580932 CATCTCTGGAGAAGGGCGGCTGG + Intronic
1123185439 14:106512105-106512127 CATTTCTGCTGAAGATCCTGGGG - Intergenic
1124374654 15:29122466-29122488 CAGTTCTGCAGGAGAGAGGCCGG - Exonic
1128432305 15:67608711-67608733 CATTTCTGTAGATGAGGAGCAGG + Intronic
1129256527 15:74337104-74337126 CTATTCTGCAGCAGAGCCGCTGG - Intergenic
1129536294 15:76315969-76315991 CATTCCTCCAGAAGACCAGCTGG - Intergenic
1130448391 15:84026163-84026185 CATTAGTGCAGAAGAGACACAGG + Intronic
1130826314 15:87549999-87550021 GATTTCTGCAGTACAGCCTCGGG - Intergenic
1136116285 16:28096956-28096978 CCTTTCTGCAGAAGAGCCATCGG + Intergenic
1139993570 16:70959698-70959720 CATTTCTGCAGAAGGCCGCCTGG - Exonic
1141861425 16:86719040-86719062 CCTTTCTGCACAAGAGCTGGTGG - Intergenic
1143544306 17:7587494-7587516 CATTCCAGTAGAAGAGCAGCTGG - Exonic
1144632118 17:16879407-16879429 CATTTCTCCAGGACAGGCGCAGG + Intergenic
1145969600 17:28949409-28949431 CCTTTCTGCAGAAGCTCCTCGGG - Intronic
1147254157 17:39172128-39172150 CATTTCTGCATACGAGCTTCAGG + Intergenic
1149380795 17:56092098-56092120 CCTTTCTGCACAAGTGCCCCAGG + Intergenic
1153915007 18:9737590-9737612 CATTTCTGCAGAAGAGCCGCAGG - Intronic
1156307095 18:35887534-35887556 CCTTTCTGCAGAAGTGGCTCAGG - Intergenic
1156469999 18:37371466-37371488 CATTCCTGCAGAGAAGGCGCTGG - Intronic
1159436673 18:68426797-68426819 GATTTCTGCAGTTGAGCCTCTGG + Intergenic
927844432 2:26464116-26464138 CATGTGTGCAGCTGAGCCGCCGG - Intronic
929052921 2:37853236-37853258 CATTTCTGATGCAAAGCCGCAGG + Intergenic
929443910 2:41988186-41988208 TATTTCTGCAGAAGGACAGCAGG - Intergenic
932369697 2:71176872-71176894 ACTTTCTGCAGAAGTGCCCCTGG - Intergenic
934896742 2:98126231-98126253 CATTTCTGCACAAGAACTTCAGG + Intronic
935116508 2:100141966-100141988 CATTTCTGCAGAAGTGACGGTGG + Intronic
936521132 2:113212794-113212816 CATTTCCCCGGGAGAGCCGCAGG + Intergenic
937876844 2:126832481-126832503 CCTTTCTGCAGAAGATGCGACGG - Intergenic
938010085 2:127821888-127821910 CATTACTGCACAGGAGCCCCAGG + Intergenic
938951376 2:136257836-136257858 AAATTCTGCAGAAGAACAGCAGG - Intergenic
941366888 2:164621118-164621140 CCTGTCTGCAGCACAGCCGCGGG + Exonic
945103963 2:206290376-206290398 AGTTTCTGCAGAAAAGCAGCTGG + Intronic
945318167 2:208392805-208392827 CATTACAGCACAAGAGCCCCGGG - Intronic
947830251 2:233134514-233134536 CATTTCTGCAGAGGAGGCTCTGG - Intronic
948590186 2:239044369-239044391 CATTTCTGCTTAAGACCCCCTGG - Intergenic
948734267 2:239989697-239989719 CATTTCTGCAGAAGGCCCTTAGG - Intronic
948999193 2:241602707-241602729 CATTTCTGCAGACGTGGCACTGG + Intronic
1171417834 20:24995481-24995503 CACTGCTGCAGAAGAGCTGCAGG + Intergenic
1171488581 20:25500926-25500948 CAATGCTGGAGAAGAGGCGCAGG + Exonic
1173002588 20:39115229-39115251 GATTTCTGCAGAAACGCCTCTGG - Intergenic
1173675410 20:44830815-44830837 CATTTGTTCAGAAGAGAAGCTGG - Intergenic
1173868011 20:46325012-46325034 GATTTCTGCAACAGAGCCACAGG - Intergenic
1180054453 21:45350110-45350132 CAGTTCTGGAGCAGAGCTGCCGG - Intergenic
1184829449 22:46974956-46974978 GATTTCTGTAGAAAAGCCACAGG + Intronic
949778366 3:7657112-7657134 CATTTCTGCTGAAGAACATCGGG - Intronic
952325179 3:32314345-32314367 AATTTCTGCAGAGCAGCCACTGG - Intronic
953447420 3:42979803-42979825 CATTTCTGCACCAGAGCTGGGGG + Intronic
959880494 3:111439803-111439825 CATTGCTGCAGAAGCTCCTCTGG - Intronic
963810679 3:149773500-149773522 TATTTCTACAGAATAGCTGCAGG - Intronic
964742548 3:159982827-159982849 CATTTATGGACAAGAGCCACAGG + Intergenic
966643807 3:182220064-182220086 CATTTCTGCATTAGGGCCACAGG - Intergenic
968741133 4:2332307-2332329 CATTTCTGCAGAAGTTCCTGCGG + Intronic
969240142 4:5892325-5892347 CCTTTCTGTAGAAGAGGAGCCGG + Intronic
969442025 4:7222849-7222871 GTTTTCTGCAGAGGAGCTGCAGG + Intronic
973173367 4:47173646-47173668 CATTTGTTCAGAAGTGCCTCAGG + Intronic
975413963 4:74087036-74087058 TATATCTCCAGAAGAGCCACAGG + Intergenic
978812854 4:112870816-112870838 CATTTCAGCAAAAGAGGCACTGG + Intronic
979223958 4:118264156-118264178 CATTTCTCCAGATAAGCTGCAGG + Intergenic
980187500 4:129480433-129480455 CATTTATGAAGAAGAGCTGAAGG - Intergenic
980486061 4:133459289-133459311 CTTTTCTGATGAAGAGCCTCTGG - Intergenic
981534622 4:145786434-145786456 CATTACTGAAGAAGAGGCTCTGG + Intronic
986468320 5:8049478-8049500 CATTTCTGCAGAAGAGTGTTGGG - Intergenic
987088569 5:14490971-14490993 CTTTTTTGCTGAAGAGCCACAGG + Intronic
992997677 5:82348620-82348642 CATTTCTGCAGACGTGTCTCTGG + Intronic
994042368 5:95273732-95273754 CATTTCTGCAGAATGGCTGAGGG - Intronic
994360551 5:98844777-98844799 CATTTTTTCAAAAGAGCCCCAGG + Intergenic
995805452 5:116047260-116047282 CGTTTCTGAAGAAGAGCTGAAGG + Intronic
997294662 5:132762028-132762050 CATTTCTCCAGAAGAGAGCCAGG - Intronic
998064213 5:139144074-139144096 CATTTCTGCAAAAAATCCACTGG - Intronic
998163174 5:139825014-139825036 GATTTGTGTAGAAGAGGCGCTGG + Intronic
998335642 5:141370151-141370173 CAGTTCTGCAGCAGAGGCGCCGG + Intronic
1003172293 6:3729410-3729432 CCTTTCTGGAGAAGGGCCACTGG + Intronic
1003597907 6:7490852-7490874 TTTTTCTGCAGAAGAGAGGCTGG + Intergenic
1006106616 6:31720760-31720782 CCTTTCTGCTGAAGAGCTACTGG - Intronic
1007872582 6:45057787-45057809 CATTTCTGCAGACAAACTGCTGG + Intronic
1017658811 6:156654452-156654474 CCTTCTTGCAGAACAGCCGCGGG + Intergenic
1019762514 7:2824252-2824274 GATTTCTGCAGAGGAGTGGCAGG - Intronic
1022146894 7:27553275-27553297 GTTTTCTGCAGAAGATCTGCAGG + Intronic
1025868232 7:65405932-65405954 CATTACTGCATAAGAACCCCAGG + Intergenic
1027595925 7:80173928-80173950 CATTTGGGCAGGAGAGCCTCTGG - Intronic
1035587425 8:786606-786628 CGTCTCTCCCGAAGAGCCGCTGG - Intergenic
1035935828 8:3837325-3837347 CATTTCTACATCAGAGCCCCAGG + Intronic
1036652492 8:10654282-10654304 CATTTGTGCAGAAGAGACTGAGG - Intronic
1038249148 8:25886772-25886794 CAGTTCTGCAAAGGAGCCCCAGG - Exonic
1042665661 8:71202618-71202640 CATTTGGGCAGAAGAGCCAAAGG + Intronic
1047934723 8:129765748-129765770 CATTTCTGAAGGAGTGCCGGAGG - Exonic
1050992612 9:12172471-12172493 CACCTCTGCAGAGGAGCCTCGGG - Intergenic
1052692121 9:31828187-31828209 CATTTTTGCAGAAGTTCCTCAGG - Intergenic
1056791871 9:89631199-89631221 CATTTCTGCAGACCAGGCACAGG - Intergenic
1188682644 X:33030201-33030223 CATTTATACAGAAGACCCACGGG - Intronic
1189291680 X:39890512-39890534 CATTGCTGCAGAACAGGCACAGG + Intergenic
1189996940 X:46647925-46647947 CATTTCTGCAGAACAGAGGGAGG - Intronic
1190725050 X:53183881-53183903 CATTTCTGCAAAAAAGCTGTTGG + Intergenic
1197701759 X:129605090-129605112 CATTTGTGCAGTGGACCCGCTGG - Intergenic