ID: 1153917343

View in Genome Browser
Species Human (GRCh38)
Location 18:9757843-9757865
Sequence TGGATGCTAATCCATCATGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 2, 2: 8, 3: 24, 4: 174}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153917334_1153917343 20 Left 1153917334 18:9757800-9757822 CCCTCTTTGAGGCCACCTGTGGA 0: 1
1: 0
2: 0
3: 25
4: 267
Right 1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG 0: 1
1: 2
2: 8
3: 24
4: 174
1153917338_1153917343 8 Left 1153917338 18:9757812-9757834 CCACCTGTGGAGGGCTAAGATGA 0: 1
1: 0
2: 2
3: 20
4: 140
Right 1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG 0: 1
1: 2
2: 8
3: 24
4: 174
1153917339_1153917343 5 Left 1153917339 18:9757815-9757837 CCTGTGGAGGGCTAAGATGACTC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG 0: 1
1: 2
2: 8
3: 24
4: 174
1153917335_1153917343 19 Left 1153917335 18:9757801-9757823 CCTCTTTGAGGCCACCTGTGGAG 0: 1
1: 0
2: 0
3: 20
4: 580
Right 1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG 0: 1
1: 2
2: 8
3: 24
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153917343 Original CRISPR TGGATGCTAATCCATCATGT CGG Intronic
900763932 1:4491306-4491328 TGGAGGCTGAGCCATCATGGAGG - Intergenic
900873408 1:5323139-5323161 TGCATACTATTCCATCATATGGG - Intergenic
904998482 1:34649858-34649880 TAGATTCGAATCCATCCTGTTGG - Intergenic
906013821 1:42554968-42554990 TGGATGGTAGACCAACATGTGGG - Intronic
906492974 1:46282327-46282349 TGGATCCTAGTCCATGCTGTGGG - Intronic
907538656 1:55190767-55190789 TGGATGCCAAACCAGCCTGTGGG + Intronic
913031278 1:114905560-114905582 TGGAAGCTAATCTACCATGTTGG - Intronic
914715421 1:150250407-150250429 TGAAAGCTAATCCACCATGTTGG - Intergenic
916956750 1:169845347-169845369 TGGCTGCTAACCCATCAGGATGG + Intronic
917663271 1:177198511-177198533 TGGGTACTAATGAATCATGTGGG + Intronic
920724566 1:208421928-208421950 TGAATGCTAACCCCTTATGTGGG + Intergenic
920974369 1:210771872-210771894 TGGAGGCAAATCCAGCATTTTGG - Intronic
923012397 1:230098794-230098816 TGGATGCTAATCTGCCACGTTGG - Intronic
924036159 1:239940693-239940715 TGGATGCTAATCTGCCATGTTGG + Intergenic
924132646 1:240927941-240927963 TGGATGCTAATCTGCCATGTTGG + Intronic
924473713 1:244365625-244365647 TGGATGCTAATTCACCATGTTGG - Intronic
1063169117 10:3490500-3490522 TGGAAGCTAATCTCCCATGTTGG + Intergenic
1065781784 10:29175663-29175685 TCTTTGCAAATCCATCATGTAGG + Intergenic
1065915625 10:30352452-30352474 TGAATTCTAATCCCTAATGTTGG + Intronic
1068138305 10:52972898-52972920 TGGATGCTAATCTGCCATGTTGG - Intergenic
1068262724 10:54603730-54603752 TAAATGCTAATCCAACATGTTGG - Intronic
1071261486 10:83923374-83923396 TTGAAGCTAAGCCATCATGCTGG - Intergenic
1071419680 10:85479678-85479700 TGGGTTATAATCCATCATGGTGG - Intergenic
1071449485 10:85780543-85780565 TGGATGATAATCCCTCCTATGGG + Intronic
1071707647 10:88016612-88016634 TGGATGCTACTTCACCAGGTTGG - Intergenic
1072890522 10:99319723-99319745 CGGAAGCTAAGCCATCATTTAGG + Intergenic
1075919476 10:126198401-126198423 TGGAGACAAATCCAGCATGTGGG - Intronic
1076832532 10:133003506-133003528 CAGATGCTAGTCCAACATGTTGG - Intergenic
1079885910 11:25988391-25988413 TGGATACTAATCCACTATGCTGG - Intergenic
1081328230 11:41771917-41771939 TGGATGCTAATTTGCCATGTTGG - Intergenic
1087435707 11:98114506-98114528 TGGATTATAATCCATAATGTGGG + Intergenic
1088045035 11:105439932-105439954 TGGATGCTAATCCACCATATTGG - Intergenic
1089374419 11:117984483-117984505 TGGATGCTAATCCACAGTTTTGG + Intergenic
1093583574 12:20810335-20810357 TGAATGCTAATGTAACATGTAGG + Intergenic
1093802983 12:23396178-23396200 TGTATGTTAACCCTTCATGTAGG - Intergenic
1098708204 12:73718851-73718873 TGGATGCTAGGCACTCATGTTGG + Intergenic
1100027313 12:90146449-90146471 TGGATGCTAATCCACCATGTTGG - Intergenic
1100117320 12:91323012-91323034 TGGCTGCTAATCAATCAGGGTGG + Intergenic
1104144687 12:126021439-126021461 TGGATGCAAATGCTTCTTGTGGG - Intergenic
1104597631 12:130130976-130130998 TGCAAACTAATCCATCAAGTGGG - Intergenic
1105045197 12:132997318-132997340 TGGAAGCTCATCGACCATGTGGG - Intronic
1105045206 12:132997373-132997395 TGGAAGCTAATCTACCATGTGGG - Intronic
1105045215 12:132997428-132997450 TGGAAGCTCATCGACCATGTGGG - Intronic
1105045223 12:132997483-132997505 TGGAAGCTCATCGACCATGTGGG - Intronic
1105713219 13:23033525-23033547 TGGATGCTAATCTGCCATGATGG - Intergenic
1106341026 13:28826658-28826680 TAGACGCTAATGCATTATGTTGG - Intronic
1107719508 13:43233058-43233080 TGTATGCCAATCCAACATGCAGG + Intronic
1114020483 14:18473928-18473950 TGAATGCTAGTCCCTCACGTGGG - Intergenic
1114071851 14:19116730-19116752 TGGAAGTGAATCCATCATGATGG + Intergenic
1114090407 14:19283234-19283256 TGGAAGTGAATCCATCATGATGG - Intergenic
1115502969 14:34065506-34065528 CGGATGCTAATCCACCATGTTGG - Intronic
1118527141 14:66658537-66658559 TGGCTGCTAACTCATCATGGTGG - Intronic
1119052482 14:71383777-71383799 ATGGTGCTAATCCATCATGAGGG + Intronic
1121900609 14:97690290-97690312 TGGACCCTAATCCAGTATGTTGG - Intergenic
1202837911 14_GL000009v2_random:92019-92041 TGAATGCTTATCCCTCATATAGG + Intergenic
1202907275 14_GL000194v1_random:82035-82057 TGAATGCTTATCCCTCATATAGG + Intergenic
1202885767 14_KI270722v1_random:105671-105693 TGAATGCTTATCCCTCATATAGG - Intergenic
1202886773 14_KI270722v1_random:114923-114945 TGAATGCTTGTCCCTCATGTAGG - Intergenic
1123689750 15:22828066-22828088 CGGAAGCTAATCCATGCTGTCGG - Exonic
1128538642 15:68509567-68509589 TGGATCCTAATCCAGTATGATGG + Intergenic
1130137179 15:81191027-81191049 TGGGTGCTAATCCCCCATGTTGG - Intronic
1131733830 15:95311363-95311385 TGAATTGTAATCCCTCATGTTGG + Intergenic
1132211470 15:100026444-100026466 TGAATGCTTATCCGCCATGTTGG + Intronic
1132524117 16:405927-405949 TGGATGCGAATCCACCACGTTGG - Intronic
1133796382 16:9049928-9049950 TGAATAATAATCCATCGTGTGGG + Intergenic
1135078789 16:19416423-19416445 GGGATGCTAATCCATCACAAAGG - Intronic
1135081958 16:19444051-19444073 TGGATAGTGATCCATCATTTTGG + Intronic
1139009371 16:62613338-62613360 TGGATGCTAATCTGCCATGTTGG - Intergenic
1139635587 16:68256434-68256456 TGGATACTAATCCACCATGTTGG - Intronic
1140888997 16:79269344-79269366 TGGTTGCAAATCCAGCCTGTAGG + Intergenic
1141417147 16:83884553-83884575 TGGATGCTAGTCTACCACGTTGG + Intergenic
1141917817 16:87112168-87112190 TAGATGCTTATCTATCATCTTGG - Intronic
1144194357 17:12875980-12876002 TCTATGTTATTCCATCATGTGGG + Intronic
1145000383 17:19300775-19300797 TGGAGGCTAATTCACCATGCTGG - Intronic
1146906839 17:36623486-36623508 TGGATGCTAATAAGTTATGTAGG + Intergenic
1203156099 17_GL000205v2_random:4957-4979 TGGATGTTTGTCCATCATATAGG - Intergenic
1203157067 17_GL000205v2_random:14393-14415 TGAATGTTTATCCATCATATAGG - Intergenic
1153181438 18:2439389-2439411 TGGCTGCTAACTGATCATGTTGG + Intergenic
1153917343 18:9757843-9757865 TGGATGCTAATCCATCATGTCGG + Intronic
1155998440 18:32357901-32357923 TGAATTCTATTACATCATGTGGG + Intronic
1158008541 18:52701829-52701851 TGAATGTTAATCCACCATGTTGG + Intronic
1158054495 18:53262155-53262177 TGGAAGCTAATCTGCCATGTTGG - Intronic
1159225727 18:65532636-65532658 TGGTTCCTAATTCAACATGTCGG + Intergenic
1160066876 18:75583804-75583826 TAAATGCTATTCCATCATATGGG + Intergenic
1161584791 19:5099548-5099570 TGGATGCTAACCTGCCATGTTGG - Intronic
1164824581 19:31275285-31275307 TGGTTGCTATTCCATATTGTAGG - Exonic
1167481433 19:49734184-49734206 TGGATGCTCATCTGCCATGTTGG - Intergenic
1168188004 19:54713518-54713540 TGGATGCAAACCCACCATGGGGG - Intergenic
1202650480 1_KI270706v1_random:174790-174812 TGAATGCTTATCCCTCATATAGG + Intergenic
1202650800 1_KI270707v1_random:1735-1757 TGAATGCTTATCCCTCATATAGG + Intergenic
1202662190 1_KI270708v1_random:81821-81843 TGAATGCTTGTCCCTCATGTAGG - Intergenic
926313791 2:11694947-11694969 TCGATGATCATCCATCATCTGGG + Intronic
927528254 2:23768857-23768879 TGAATACTAATCCATTATATGGG + Intronic
928432584 2:31233365-31233387 TGGATGTCAATTCATCATTTAGG + Intronic
935730434 2:106060737-106060759 GGGATCCTAAGCCATCATGCTGG + Intergenic
939983744 2:148811036-148811058 TGGATGCTAATCTGCTATGTTGG - Intergenic
941895954 2:170629286-170629308 TGGCTGCTAATCCAGGAAGTGGG - Intronic
941985260 2:171504444-171504466 TGGCTGCTAATCCACCACATGGG + Intergenic
942538259 2:176988462-176988484 TGGATGCTCATCTTCCATGTTGG + Intergenic
943383650 2:187177765-187177787 TGGAGGCCTAGCCATCATGTGGG - Intergenic
944083895 2:195821730-195821752 TGGATGCTAATCCACCAAGTTGG - Intronic
1168922981 20:1556599-1556621 TGGGTGCTAATCCAATATGGTGG + Intronic
1170753995 20:19181380-19181402 TGGATGCTAAACCAGTATTTGGG - Intergenic
1173735070 20:45354745-45354767 TGGATGCTGATTCACCGTGTGGG - Intergenic
1174432753 20:50482554-50482576 TGGAAGCTAATCCGCCATGTTGG + Intergenic
1174510477 20:51047739-51047761 TGGAAGCTAATCCACCATGTTGG - Intergenic
1176601330 21:8797775-8797797 TGAATGCTTATCCCTCATATAGG - Intergenic
1176626640 21:9096954-9096976 TGAATGCTTATCCCTCATATAGG + Intergenic
1177272454 21:18867080-18867102 TGGATGCTCATCAAGGATGTTGG + Intergenic
1177770084 21:25504384-25504406 TGGATGATCCTCCATAATGTGGG + Intergenic
1178738098 21:35171025-35171047 TGGAAGCTAATCTACCATGTTGG + Intronic
1179620231 21:42609669-42609691 TGGATGCTAATCTGCCATGTTGG - Intergenic
1180234586 21:46450115-46450137 TGAATTCTAATCCCTAATGTTGG + Intergenic
1180256008 21:46628043-46628065 TGGATGCTGATCCTCCGTGTTGG - Intergenic
1180328640 22:11456005-11456027 TGAATGCTTATCCCTCATATAGG - Intergenic
1180329010 22:11459411-11459433 TGAATGCTTGTCCCTCATGTAGG - Intergenic
1180329015 22:11459459-11459481 TGAATGCTTGTCCGTCATGTAGG - Intergenic
1180343615 22:11689312-11689334 TGAATGCTTATCCCTCATATAGG - Intergenic
1180444990 22:15404753-15404775 TGAATGCTAGTCCCTCACGTGGG - Intergenic
1180490292 22:15839085-15839107 TGGAAGTGAATCCATCATGATGG + Intergenic
950077786 3:10199506-10199528 AGGATTCTCATCCATCAAGTGGG + Intronic
951554235 3:23904475-23904497 AGGATGCTAATCTTTCATGAGGG + Intronic
954623256 3:52007564-52007586 TGAATCCTGAACCATCATGTGGG + Intergenic
955202191 3:56861368-56861390 TGGAACCTAATCTATCATCTAGG + Intronic
960146004 3:114203607-114203629 CGGTTGCTAATCCAACATTTGGG + Intergenic
960856110 3:122103796-122103818 TGGATGCGAATCATTCCTGTGGG - Exonic
966345835 3:178978685-178978707 TGGGAGCAAATCCACCATGTTGG - Intergenic
967696059 3:192531915-192531937 TATATGCTAATCCAGAATGTAGG - Intronic
970841485 4:20476807-20476829 GAGATGCTAGTCCATCATTTAGG - Intronic
973364653 4:49199567-49199589 TGAATGCTTATCCCTCATATAGG - Intergenic
973395937 4:49592883-49592905 TGAATGCTTATCCCTCATATAGG + Intergenic
973396257 4:49595696-49595718 TGAATGCTTATCCCTCATATAGG + Intergenic
973644366 4:52935385-52935407 TGAAAGCTAATCTACCATGTTGG + Intronic
974636671 4:64572699-64572721 TGAATGGTAATCCTTAATGTTGG + Intergenic
977518150 4:98047622-98047644 TAGAAGCCAATCCCTCATGTAGG + Intronic
978047812 4:104153811-104153833 TGAATGTTAATCCGTAATGTTGG + Intergenic
982339105 4:154275424-154275446 TGGATTATAATCAATCATGGTGG + Intronic
1202762060 4_GL000008v2_random:121271-121293 TGAATGCTTATCCCTCATATAGG - Intergenic
986636188 5:9824356-9824378 TGGCTGCTGTTCCATCAAGTCGG - Intergenic
988134751 5:27156854-27156876 AGGCTGCTTCTCCATCATGTGGG - Intergenic
989002410 5:36774995-36775017 TGGATGCTAATCTATACTTTTGG - Intergenic
989816347 5:45742279-45742301 TGAATGCTAATCTTCCATGTGGG - Intergenic
990548515 5:56848735-56848757 TGGAAACTAATCCATGATTTAGG + Intronic
991077735 5:62560226-62560248 TGAATGCTAATCCAATATGATGG - Intronic
993754744 5:91714470-91714492 TGAATTCTAATCCCTAATGTTGG - Intergenic
994578096 5:101607361-101607383 TGGATGTTAATCTACCATGTTGG + Intergenic
994604435 5:101949266-101949288 TGGAAGCTAATCTGCCATGTTGG - Intergenic
996554962 5:124768947-124768969 TGGATGATACTCCATCTTGACGG + Intergenic
996633817 5:125666892-125666914 TGGACCCTAATCCAGCATGCTGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1001204006 5:169745198-169745220 AGGATCCTAATCCAGCATGGTGG - Intronic
1001740135 5:174046299-174046321 TGGTTGCTATTCTATTATGTTGG - Intronic
1002285405 5:178159549-178159571 TGGATGCTAATCTACTATGTTGG - Intergenic
1004154441 6:13155097-13155119 TGGATGCTAATCCACCATGTTGG + Intronic
1004315151 6:14580382-14580404 TGGATGCTAATCAGCCATGTTGG + Intergenic
1004920688 6:20372652-20372674 TGGATGTGAATCCGCCATGTTGG - Intergenic
1008184574 6:48373011-48373033 TCTATGCTAATCCACCATGTTGG - Intergenic
1012263130 6:97111157-97111179 TGGAGGCTTAGCCACCATGTGGG - Intronic
1012778118 6:103522825-103522847 TTGATGCTATTCCTTTATGTTGG - Intergenic
1014558162 6:122858202-122858224 TGGCTGCTAATACATCATTCTGG - Intergenic
1015710338 6:136132301-136132323 TGGGTGCTGATACATCATTTTGG + Intronic
1016764508 6:147777010-147777032 TGGAAACTAATCAATCAAGTTGG - Intergenic
1018359893 6:163056763-163056785 TGGGTGCTAATCTGCCATGTTGG - Intronic
1018857855 6:167688298-167688320 TGGGTGCTGATCCTTCATGGGGG + Intergenic
1019060301 6:169252640-169252662 TGGCTGCTCATCCTTCCTGTGGG - Intronic
1021133083 7:16934666-16934688 TGGATGCTAACCCATCTGGCAGG + Intergenic
1021782112 7:24116430-24116452 TGGATGCTGATTCATTATGTTGG - Intergenic
1023503159 7:40872178-40872200 AGGAAGCTAATCCTTCAGGTGGG + Intergenic
1026260934 7:68754851-68754873 TGGAAGCTAATCTGCCATGTTGG - Intergenic
1027439333 7:78201676-78201698 TGGAACCTAATTCATAATGTAGG - Intronic
1031714848 7:125096332-125096354 AGGATGCTAATCCATCATGAGGG + Intergenic
1032387131 7:131532799-131532821 AGGACACTAATCCATCATGGAGG - Intronic
1033224658 7:139551312-139551334 GGGATGCTAAGCCAATATGTAGG + Intergenic
1034070567 7:148180772-148180794 TGGATGCTAATGCACCATGCTGG - Intronic
1037657764 8:20900702-20900724 TGGATGCTAATCTGCCCTGTTGG - Intergenic
1037896997 8:22664100-22664122 TGGTGGCTAATCCATCAAATAGG - Intronic
1038102123 8:24389149-24389171 TGGATGCTAATCTGGCAAGTTGG - Intronic
1039284139 8:36022044-36022066 TGGATGCTAATCTGCCATGTTGG + Intergenic
1039729736 8:40261480-40261502 TGGATTGTAATCCCTAATGTTGG - Intergenic
1039783470 8:40811505-40811527 TAGATGCTAATCCACTACGTTGG - Intronic
1041132693 8:54718980-54719002 TGTATGCAAATACATCATTTAGG + Intergenic
1043731293 8:83686809-83686831 TGGATGTTAATCTGCCATGTTGG + Intergenic
1043877371 8:85500946-85500968 TGGATGCTAATCTGCCGTGTTGG - Intergenic
1044024888 8:87156502-87156524 CGGCTGCAAATCCATCATTTTGG - Intronic
1044216951 8:89623351-89623373 TGGATTGTAATCCCTAATGTTGG - Intergenic
1045726738 8:105182801-105182823 TGAATTCTAATCCCTAATGTTGG + Intronic
1046671314 8:117059631-117059653 TGGTTTCTACTCCATCATGTTGG + Intronic
1047383565 8:124386945-124386967 TGGAAGTTAATCCATCATGTTGG - Intergenic
1050082425 9:1928991-1929013 TGGAAAATAATCCCTCATGTTGG + Intergenic
1051096316 9:13469677-13469699 TGGATGCTCATCTGCCATGTTGG - Intergenic
1052716781 9:32127350-32127372 TGCAAGCTACTCCATCATATTGG + Intergenic
1053717812 9:40914642-40914664 TGAATGTTTATCCCTCATGTAGG + Intergenic
1055017220 9:71631880-71631902 TAGATGATAAGCCATCTTGTTGG - Intergenic
1058787473 9:108404423-108404445 TGTATGCTACTCTATTATGTAGG + Intergenic
1059308522 9:113373101-113373123 AGGATGCTAAGCCATTCTGTAGG - Intergenic
1060383006 9:123194461-123194483 TGGGTGCTATTACAACATGTGGG - Intronic
1203484314 Un_GL000224v1:38231-38253 TGAATGTTTATCCCTCATGTAGG - Intergenic
1203542825 Un_KI270743v1:106152-106174 TGAATGCTTATCCCTCATATAGG - Intergenic
1185882196 X:3751319-3751341 TGAATGGTAATCCATGGTGTTGG + Intergenic
1187765366 X:22635821-22635843 TTGGTGCTCATCCATAATGTGGG - Intergenic
1191857572 X:65639570-65639592 TGGTTTCTAAGCCAGCATGTGGG + Intronic
1193977599 X:88141961-88141983 TGGAGGCTAATCCAGGATGAAGG + Intergenic
1194597417 X:95875829-95875851 TGGCAGCTAATCTGTCATGTTGG + Intergenic
1194759983 X:97784575-97784597 TGGATGCTAACTGATCATGATGG - Intergenic
1195630303 X:107048889-107048911 TGGAAGCTAATCCACCATGCTGG - Intergenic
1196740595 X:119021954-119021976 TGGATGCGAAGTCAACATGTTGG - Intergenic
1197209689 X:123818646-123818668 TGGAAGCTATTTCACCATGTTGG + Intergenic
1199346137 X:146743388-146743410 TGGATGCTAATCCACTACATTGG + Intergenic
1200782776 Y:7231892-7231914 TGAATGGTAATCCGTGATGTTGG - Intergenic