ID: 1153919940

View in Genome Browser
Species Human (GRCh38)
Location 18:9779733-9779755
Sequence TGGGCTTAAGCCAAGCTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153919930_1153919940 -3 Left 1153919930 18:9779713-9779735 CCCTTACCTCACCCCTCCTTTGG 0: 1
1: 0
2: 1
3: 20
4: 257
Right 1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 128
1153919934_1153919940 -9 Left 1153919934 18:9779719-9779741 CCTCACCCCTCCTTTGGGCTTAA 0: 1
1: 0
2: 2
3: 19
4: 192
Right 1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 128
1153919932_1153919940 -4 Left 1153919932 18:9779714-9779736 CCTTACCTCACCCCTCCTTTGGG 0: 1
1: 0
2: 1
3: 23
4: 285
Right 1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 128
1153919928_1153919940 26 Left 1153919928 18:9779684-9779706 CCTGTATTTGTGTTTGCTGAAGG 0: 1
1: 0
2: 1
3: 11
4: 231
Right 1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG 0: 1
1: 0
2: 1
3: 11
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153919940 Original CRISPR TGGGCTTAAGCCAAGCTGGT TGG Intronic
900320129 1:2079428-2079450 TGGGCTTAAGCCCAGCCCTTGGG - Intronic
900547887 1:3238666-3238688 TGGGCTCCAGCAAAGCTGGGCGG - Intronic
901144686 1:7057035-7057057 TGGCCCTAAGCCATGCAGGTGGG - Intronic
901902316 1:12375745-12375767 GGGGCTGAAGCCAAGTTGGGAGG - Intronic
902943715 1:19818625-19818647 TGTTCCTAAGCCAAGATGGTAGG - Intergenic
904629557 1:31830672-31830694 TGGGCTGCAGCCAAGGTGGCTGG + Intergenic
907284195 1:53369854-53369876 AGGGCTCAAGCCAGGCAGGTTGG - Intergenic
911464903 1:98239232-98239254 TGGGCTTAATCCCAGGTGATGGG + Intergenic
913199389 1:116483869-116483891 TTGGCTTAAGCAAAGCTTGCTGG + Intergenic
919805117 1:201376872-201376894 TGGGTGTGAGCCCAGCTGGTTGG - Intronic
923546519 1:234927490-234927512 TGGGCTGAGGCCAGGCTGGGTGG - Intergenic
924549206 1:245058887-245058909 TGTGCATAAGCCTACCTGGTAGG - Intronic
1063368828 10:5507845-5507867 TGGACTTCAGCCCAGCAGGTAGG - Intergenic
1064831783 10:19476582-19476604 TGTGCTTACCCCAGGCTGGTGGG + Intronic
1066504102 10:36024090-36024112 TGGGCTTAGCCCATGATGGTTGG - Intergenic
1067096087 10:43301173-43301195 GGGGGTTCAGTCAAGCTGGTGGG - Intergenic
1067295858 10:44974944-44974966 AGGGCTTTAGCCAGGCTGGCTGG + Intronic
1067335077 10:45354731-45354753 TGGGCTTAAACAAAGGTTGTGGG + Intergenic
1068425989 10:56864675-56864697 TGGGCTTATGTCAAGCAGGGAGG + Intergenic
1069822384 10:71235755-71235777 TGGTCTGAAGCCCAGTTGGTGGG - Intronic
1071597086 10:86936236-86936258 TGGGATTAAACCAACCTGCTTGG - Exonic
1072516468 10:96188195-96188217 TGGGCTTTAGAGAAGCAGGTGGG + Intronic
1072623808 10:97098354-97098376 TGGGATGAAGCCAAGCTGCTAGG + Intronic
1074174933 10:110989394-110989416 TTGGCTGAAGTCAATCTGGTTGG + Intronic
1075563063 10:123482403-123482425 TGGGTTTAATCCCAGCTGGGTGG + Intergenic
1076067862 10:127463537-127463559 TGGGCTTCAGGCAGGCTGGGAGG - Intergenic
1080619881 11:33978504-33978526 TGTACTTAAACCAGGCTGGTGGG - Intergenic
1083222115 11:61259239-61259261 TGGCATTCAGCAAAGCTGGTCGG - Exonic
1085503938 11:77045201-77045223 TGCTTTTAAGCCAAGCTTGTGGG - Intergenic
1088209918 11:107443515-107443537 TGGGCTTAACTCAAACTAGTGGG - Intronic
1090133270 11:124168368-124168390 TGGGGTTCAATCAAGCTGGTGGG - Intergenic
1090321654 11:125849897-125849919 TGGGCTTAAGCCCAGGTGATGGG + Intergenic
1093077819 12:14775118-14775140 TGGGCTTGAGCCACTCTGGACGG + Intronic
1093895071 12:24565407-24565429 TGGGGTTAGGCCAAGCAGGTAGG - Intergenic
1096085542 12:48862953-48862975 TGGGGGGAATCCAAGCTGGTGGG + Intronic
1096738524 12:53675304-53675326 TGGGGTAAGGCCAAGCTAGTGGG - Intronic
1100223709 12:92534892-92534914 TGGGCCTCAGCAAAGCTTGTTGG + Intergenic
1103693471 12:122794956-122794978 TGGGCTTAAGCCAAGCACGATGG - Intronic
1107422095 13:40256714-40256736 TGGGGTTAGGCAAAGCGGGTGGG + Intergenic
1112158938 13:96848739-96848761 TGGGGTTCAGTCAGGCTGGTAGG - Intergenic
1116250504 14:42475724-42475746 TGGGGTTCAGACAGGCTGGTGGG - Intergenic
1117050540 14:51855415-51855437 TGAGCCTAAGCCCAGCTGTTAGG - Intronic
1118088463 14:62445663-62445685 TGGGCTTGAGCCAAGCTAACTGG + Intergenic
1119483711 14:74975151-74975173 TGGGCTTCGGCCAAGCTGGCCGG + Intergenic
1121026666 14:90621216-90621238 TGGGCAGAAGCCACGCAGGTAGG + Intronic
1123499759 15:20868974-20868996 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1123557007 15:21442672-21442694 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1123593232 15:21879937-21879959 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1128832961 15:70786289-70786311 TGGGCTGAAGTCAAGCTGCTGGG - Intergenic
1129820768 15:78600364-78600386 TGCGCCTAAGCCAGGATGGTGGG + Intronic
1130710014 15:86270857-86270879 TAGGCTGAAGCCAAGGTGTTGGG + Intronic
1131213021 15:90513908-90513930 TGGGGTTCAGTCAGGCTGGTGGG - Intergenic
1202965351 15_KI270727v1_random:169861-169883 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1133144770 16:3776514-3776536 AGGGGTTAAGCCCAGCTGGCTGG - Intronic
1134096854 16:11424028-11424050 TGGGCAGAAGCAAAGCTGTTGGG + Intronic
1134889195 16:17823723-17823745 TGGGCTTAAGCCAAACTCTTTGG - Intergenic
1136292320 16:29282779-29282801 TGGGTTTTAGCCATGCTGTTAGG + Intergenic
1136520584 16:30793367-30793389 TGGGATTCAGTCAGGCTGGTAGG - Intergenic
1141936476 16:87242354-87242376 TGGTCTTAAGGCAAGTTGGGAGG - Intronic
1142098212 16:88256734-88256756 TGGGTTTTAGCCACGCTGTTAGG + Intergenic
1144889753 17:18487815-18487837 TGTGCTTAGGCCCAGCTGGGGGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147976754 17:44252438-44252460 TGGGCTTAAGTCAGGCAGGCAGG - Intronic
1149185145 17:53989066-53989088 TGGTCTGAAGCAACGCTGGTTGG + Intergenic
1153919940 18:9779733-9779755 TGGGCTTAAGCCAAGCTGGTTGG + Intronic
1154457844 18:14546187-14546209 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1158556674 18:58480871-58480893 TGGGCATGACCCAAACTGGTAGG + Intergenic
1162934709 19:13976088-13976110 TGTGGTTGAGCCAAGCTGGCAGG - Intronic
1164600875 19:29562507-29562529 GGGGCTGCAGCCCAGCTGGTGGG + Intronic
1165126904 19:33604546-33604568 TGGGCATAAACCAGGATGGTGGG + Intergenic
1165943553 19:39427878-39427900 TAGACTTAAGCCAAGCTGTGTGG - Exonic
926045473 2:9706535-9706557 AGAGTGTAAGCCAAGCTGGTGGG + Intergenic
928626744 2:33147689-33147711 CAGGCTTAAGCCATCCTGGTAGG - Intronic
934519148 2:95008436-95008458 TGGCCTTAAGCCAAGCTGAGCGG - Intergenic
935268597 2:101414830-101414852 TAGGCTTCAGCCAAGCAGATAGG - Intronic
935299025 2:101676714-101676736 TGGGCTTCAGCCTAACTGGCTGG - Intergenic
937497349 2:122435367-122435389 TGGGATTTTGCCAAGATGGTAGG - Intergenic
942312550 2:174668891-174668913 TGGGCTGAAGCCACGCTGCCTGG + Intronic
948146437 2:235711629-235711651 TGGGCTAGAGCAGAGCTGGTGGG - Intronic
948991170 2:241554835-241554857 TGTGCTTAAGCCAGTCTGGTGGG + Intergenic
1170268600 20:14498922-14498944 TGGGCTTCAGGCATGCTGGGAGG + Intronic
1170846593 20:19966967-19966989 TGGCCTAAAGCCAACCAGGTTGG + Intronic
1172072955 20:32272132-32272154 TGGGCTTAATTCCAGCTGGGTGG + Intergenic
1172842799 20:37912173-37912195 CGGGCTTGAGCCCAGCTTGTGGG + Intronic
1173202583 20:40965137-40965159 TGGGCTTAATCCTAGGTGATGGG - Intergenic
1173448541 20:43141940-43141962 TGGTCTTAAGGAAAGCTGCTCGG - Intronic
1176816312 21:13607120-13607142 TGGGCTTAAACCGAGGTGATGGG - Intergenic
1180165174 21:46022007-46022029 TGGGCTCTAGCCCAGATGGTGGG - Intergenic
1181464321 22:23102577-23102599 TGGGCTCAAGCCCTGCTGCTTGG + Intronic
1181857296 22:25791190-25791212 TAGGCTGAGGCCAAGCTGGGAGG + Intronic
1184980299 22:48090832-48090854 TGGACTTGATCCCAGCTGGTGGG + Intergenic
955268517 3:57472376-57472398 TAGGCTTAAGACAAGCTGTTAGG - Intronic
955347168 3:58169776-58169798 TGGACTGCAGCAAAGCTGGTAGG + Exonic
955449856 3:59054235-59054257 TTGGTTTAAGCCAAGTTGTTTGG - Intergenic
955758216 3:62248956-62248978 TGGGATTAAACCAACCTTGTTGG + Intronic
956331094 3:68110071-68110093 TGGGCTTAATACAAGGTGATGGG - Intronic
956661981 3:71608060-71608082 TGCACTTAAGCCAAAATGGTAGG - Intergenic
956902938 3:73735801-73735823 GGGGCTTAAGGTAAGCTGGAGGG + Intergenic
959406292 3:105965756-105965778 TGGGCTTAAGAGGAGATGGTAGG + Intergenic
959864910 3:111255049-111255071 TGGGTTTAAGCCAAGGTTGGAGG - Intronic
959889779 3:111541548-111541570 TGGCCTCCAGCCAACCTGGTGGG + Intronic
962377323 3:134869233-134869255 TTTGCTTAAGCCAAGTGGGTTGG - Intronic
962386648 3:134937503-134937525 TGAGCGTAAGCCATGCTGGCTGG - Intronic
963458694 3:145578672-145578694 TGGAGGTCAGCCAAGCTGGTAGG + Intergenic
966387883 3:179420586-179420608 TGGGCATAATCCCAGCTAGTCGG - Intronic
969867551 4:10085533-10085555 TGGGCCTGAGCCCTGCTGGTGGG - Intronic
976994839 4:91417740-91417762 TGGGCTTAATCCTAGGTGATGGG + Intronic
978934859 4:114361780-114361802 TGTGCTTGAGCCCAGCTTGTGGG - Intergenic
979209834 4:118086563-118086585 TGTCCTTAGGCCAAGATGGTTGG - Intronic
980837760 4:138217776-138217798 GGGGCTGAAGCCAAGCTACTGGG - Intronic
991009280 5:61865967-61865989 GGGGCTTAAGCAATCCTGGTTGG - Intergenic
991677090 5:69098335-69098357 TGGGTTTTTGCCATGCTGGTTGG - Intronic
993065910 5:83096463-83096485 GGGGCTGAAGCCAAGCCGTTTGG + Intronic
1001186300 5:169576361-169576383 TGGGCTTTACCCCAGCTGCTTGG + Intergenic
1017346581 6:153390491-153390513 TGGGCTTGAGCCAATCTGGTCGG + Intergenic
1022646161 7:32230259-32230281 TGGGCTCACGCCAAGGTGATAGG + Intronic
1022683690 7:32574750-32574772 TGGGCCTAAGCCAAACTGTTTGG - Intronic
1029199733 7:98830714-98830736 ATGGCTTAAGCCCAGCAGGTTGG + Intergenic
1029506698 7:100967317-100967339 TGGGTTTCAGCCAAGTTGGAAGG - Exonic
1032496730 7:132368461-132368483 TGAGCCTAAGCCCAGCTGGCAGG + Intronic
1035118034 7:156541205-156541227 TGGGCTTAAGCCAGCTTAGTTGG + Intergenic
1036658190 8:10691106-10691128 TGGGTTTCAGCAAAGCTTGTTGG - Intronic
1037981967 8:23260911-23260933 TGGGCTGGAACGAAGCTGGTGGG - Exonic
1038542326 8:28400393-28400415 TGGGTTTAAACAAAGTTGGTAGG + Intronic
1038791859 8:30675230-30675252 TGGGGTTAGGCTCAGCTGGTTGG - Intergenic
1047818518 8:128492301-128492323 TGGGCTAAAGTCAAGCTGTCAGG - Intergenic
1048221198 8:132543692-132543714 TGGGCATGAGCCAAGCTCCTCGG - Intergenic
1049657471 8:143805145-143805167 TGGGCTTCAGCATTGCTGGTGGG - Exonic
1055843604 9:80534404-80534426 TGGGCTTAATCCTAGGTGATGGG + Intergenic
1056250938 9:84747414-84747436 TGGGCTTAATACATGCTGCTTGG - Intronic
1056694269 9:88833062-88833084 TGAGCTTCATCCAAGCTAGTGGG - Intergenic
1056950064 9:91034655-91034677 TGGTGCTAACCCAAGCTGGTGGG - Intergenic
1061418428 9:130460687-130460709 TGGGCTGAGGCCATGCTGGGAGG + Intronic
1061564227 9:131426964-131426986 ATGGCTTCAGCCATGCTGGTTGG - Intronic
1061953692 9:133950494-133950516 TGGGTTTAAGCCAAGGCGGGGGG + Intronic
1203531045 Un_GL000213v1:142347-142369 TGGGCTTAAACCGAGGTGATGGG + Intergenic
1186178884 X:6953762-6953784 TGGGCTTCAGCCAGGCTTGGAGG - Intergenic
1187449102 X:19381361-19381383 AGGGCTTCAGCCAGGCTGCTGGG + Intronic
1201273367 Y:12277067-12277089 TGGGCTTTCACCAAGTTGGTCGG - Intergenic
1201782501 Y:17739058-17739080 TGGGGTTCAGTCAAGATGGTGGG + Intergenic
1201819052 Y:18166930-18166952 TGGGGTTCAGTCAAGATGGTGGG - Intergenic