ID: 1153929974

View in Genome Browser
Species Human (GRCh38)
Location 18:9869773-9869795
Sequence CTCCTTTTACAGAAGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153929972_1153929974 12 Left 1153929972 18:9869738-9869760 CCGCAAAACAAATCTGAGATAGA No data
Right 1153929974 18:9869773-9869795 CTCCTTTTACAGAAGGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153929974 Original CRISPR CTCCTTTTACAGAAGGAGCA TGG Intergenic
No off target data available for this crispr