ID: 1153932206

View in Genome Browser
Species Human (GRCh38)
Location 18:9887864-9887886
Sequence CACTGAAGGAGGCCGGGGAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 626
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 576}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153932199_1153932206 3 Left 1153932199 18:9887838-9887860 CCTGAGCAAGGAGGACTTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 216
Right 1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG 0: 1
1: 0
2: 1
3: 48
4: 576
1153932195_1153932206 30 Left 1153932195 18:9887811-9887833 CCCGGAGGGGGACAAGGTGAAAG 0: 1
1: 0
2: 3
3: 20
4: 276
Right 1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG 0: 1
1: 0
2: 1
3: 48
4: 576
1153932196_1153932206 29 Left 1153932196 18:9887812-9887834 CCGGAGGGGGACAAGGTGAAAGT 0: 1
1: 0
2: 1
3: 12
4: 212
Right 1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG 0: 1
1: 0
2: 1
3: 48
4: 576

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153932206 Original CRISPR CACTGAAGGAGGCCGGGGAG AGG Exonic
900142579 1:1144876-1144898 GACTGAGGGAGGCCTCGGAGGGG - Intergenic
900250605 1:1666772-1666794 CACTGTGGGAGGCCGGGCACGGG + Intronic
900278218 1:1847131-1847153 CACTGAAGGCAGGCAGGGAGAGG + Intronic
900393816 1:2444959-2444981 CACCATGGGAGGCCGGGGAGGGG + Intronic
900407472 1:2498910-2498932 CACTGAGGGAGGCCTGGGCAGGG - Intronic
901374313 1:8826600-8826622 CACTCTGGGAGGCCGAGGAGTGG + Intergenic
901689111 1:10961032-10961054 CAGTGAAGGATGCCAGGGACTGG + Intronic
901926708 1:12570810-12570832 GACTGAGGGAGGCCGAGGTGTGG + Intronic
902077676 1:13800783-13800805 CACTGAAGGAGGGTTGGGGGGGG + Intronic
902338465 1:15767442-15767464 CACTGGAGGGGGCGGTGGAGGGG - Exonic
902793387 1:18784447-18784469 CAATGAGGAAGGGCGGGGAGGGG - Intergenic
903902574 1:26658813-26658835 CACTTTGGGAGGCCGGGGGGGGG + Intergenic
904238621 1:29129818-29129840 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
904651235 1:32007452-32007474 CGCTGGAGCAGGCCGGAGAGAGG + Intergenic
904935441 1:34126666-34126688 CACTGCAGGAGGGAGTGGAGTGG + Intronic
905222331 1:36457029-36457051 CACTTTAGGAGGCCGAGGTGGGG + Intronic
905553222 1:38860013-38860035 CCCGGAAGAAGGCAGGGGAGCGG - Intronic
905574910 1:39036349-39036371 CACTTTGGGAGGCCGGGGCGGGG - Intergenic
905575629 1:39042248-39042270 CACTTTGGGAGGCCGGGGAGGGG + Intergenic
905639995 1:39582587-39582609 CACTTTGGGAGGCCGTGGAGGGG - Intergenic
905865906 1:41376526-41376548 CACTGAGGGGTGCCAGGGAGAGG - Intronic
906151211 1:43588710-43588732 CACTGCAGGAGGAGGGAGAGAGG - Exonic
906310010 1:44747060-44747082 CACTTTAGGAGGCCGAGGTGGGG + Intronic
906798934 1:48719365-48719387 CACTTAAGGAGGAAGGGGGGTGG + Intronic
908370034 1:63472480-63472502 CATGGAAGGAGACCGTGGAGAGG - Intronic
909539140 1:76771335-76771357 CACTGAGTGAGCCGGGGGAGTGG + Intergenic
910924963 1:92388714-92388736 CACTGAACCAGGCATGGGAGGGG - Exonic
910971837 1:92863805-92863827 CACTTTGGGAGGCCGAGGAGAGG + Intronic
912166683 1:107049782-107049804 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
912475061 1:109929724-109929746 CAGTGCAGGAGGCTGGGGAGAGG - Exonic
912798578 1:112707138-112707160 CGCTGGAGGAGGGCGGGGCGGGG - Intronic
913644735 1:120845127-120845149 CGGTGAAAGAAGCCGGGGAGCGG + Intergenic
914004238 1:143718303-143718325 CAGGGAAAGAAGCCGGGGAGCGG + Intergenic
914516670 1:148379961-148379983 CAAGGAAAGAAGCCGGGGAGCGG + Intergenic
915254345 1:154614541-154614563 CACTGCAGAAGGCAGGGCAGTGG - Intronic
915533368 1:156517543-156517565 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
915629974 1:157145746-157145768 CACTTTAGGATGCCGAGGAGGGG - Intergenic
917146077 1:171893107-171893129 CACTGAAGGGGTAAGGGGAGAGG - Intronic
918889075 1:190240622-190240644 CACTTTGGGAGGCCGAGGAGGGG + Intronic
919567487 1:199207099-199207121 CACTTTGGGAGGCCGGGGCGTGG + Intergenic
920215994 1:204361865-204361887 CCCAGAGGGAGGCCGGGGAGGGG + Intronic
920224933 1:204431623-204431645 CACAGAGGGATGTCGGGGAGGGG - Intronic
920378175 1:205520451-205520473 CACTTTGGGAGGCCGAGGAGGGG + Intronic
920432714 1:205929006-205929028 CCCCTAAGGAGGCAGGGGAGTGG - Intronic
921326125 1:213987725-213987747 CGGGGATGGAGGCCGGGGAGGGG + Intronic
921357513 1:214299849-214299871 CACTTTGGGAGGCCGAGGAGGGG - Intronic
921707902 1:218345461-218345483 AAGTGAAAGAGGCAGGGGAGGGG + Intergenic
921714227 1:218401788-218401810 CACTGAGGGAGCCCGGGGTAGGG - Intronic
922385404 1:225076176-225076198 CACTGAAGGTGGCATGGTAGTGG + Intronic
922867655 1:228873865-228873887 CACTGAAGGAGGGCTGGGATGGG + Intergenic
923364415 1:233245532-233245554 CACTGGAGGGGGCAGGGCAGAGG + Intronic
924481603 1:244440067-244440089 CACTGAAAGAGGCATGGAAGAGG - Intronic
924606414 1:245539315-245539337 CATTGAAGGAGACCGGGGTCGGG + Intronic
924712622 1:246543078-246543100 CACTTGAGGAGGCCGGGGATTGG - Intronic
1063241442 10:4174135-4174157 CACTTTAGGAGGCTGGGGAGAGG - Intergenic
1064599033 10:16974614-16974636 CACTTTAGGAGGCCGAGGCGGGG - Intronic
1064723720 10:18256570-18256592 CTGTGGAGGAGGCGGGGGAGTGG - Intronic
1064752024 10:18539675-18539697 AACGGAATGAGGCTGGGGAGTGG + Exonic
1065533939 10:26699640-26699662 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1065823005 10:29543692-29543714 GACTAAAGGAGGCAGGGGAGAGG - Intronic
1065890441 10:30116772-30116794 CACTTTAGGAGGCTGAGGAGGGG + Intergenic
1066250391 10:33627244-33627266 CATTGAAGGAGGTGGGGAAGGGG + Intergenic
1066502316 10:36006290-36006312 CATTGGAGGAGGCTGGGGTGGGG - Intergenic
1067435423 10:46273206-46273228 CAGGGAAGGAGGCAGGGTAGAGG + Intergenic
1067582221 10:47452896-47452918 CAGGGAAGGAGGCAGGGCAGAGG + Intergenic
1067986204 10:51148971-51148993 CACTGAGGTAGGCAGGGGATGGG - Intronic
1068360168 10:55967265-55967287 CACTTTAGGAGGCCGAGGGGTGG - Intergenic
1069025622 10:63537739-63537761 CACAGATGGAGGCAGGGAAGGGG + Intronic
1069381816 10:67849550-67849572 CACTTACGGAGGGCGGGGGGCGG - Intergenic
1069520273 10:69113638-69113660 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1069597898 10:69684491-69684513 CCCTGATAGAGGCCGGGGCGGGG - Intergenic
1069961169 10:72080396-72080418 CACTGAAGAAGGCCCAGGACTGG + Intronic
1070059579 10:72968783-72968805 TACTGAAGGAGGCACTGGAGAGG - Intergenic
1070146351 10:73776444-73776466 CACTTTGGGAGGCCGAGGAGAGG + Intronic
1070272310 10:74968124-74968146 CACTGAAGCGGGGAGGGGAGAGG - Intronic
1070328815 10:75403999-75404021 CAGAGAAAGAAGCCGGGGAGGGG - Intergenic
1070464115 10:76702761-76702783 CACTGAAGGAGGCACTGAAGAGG + Intergenic
1070556706 10:77533604-77533626 CAGTGATGGAGGTGGGGGAGGGG - Intronic
1071481025 10:86065099-86065121 CAGTGAGGGAGGCCGGGTGGTGG - Intronic
1071494050 10:86155677-86155699 CAGTGAAAAAGGCAGGGGAGTGG - Intronic
1071511409 10:86264718-86264740 CTCTGAAGGAGGCAGGGGCTGGG - Intronic
1071626870 10:87181133-87181155 CACTTTGGGAGGCCGGGGTGGGG + Intronic
1073135113 10:101216018-101216040 GACTGAAGGAGGCGGGGCATGGG + Intergenic
1073291368 10:102414855-102414877 CTCTGAAGGGGCCCGGTGAGTGG - Exonic
1074037331 10:109753565-109753587 CAGTGGAGGTGGCAGGGGAGTGG + Intergenic
1074938083 10:118206740-118206762 TACTGAAGGGGGTGGGGGAGTGG - Intergenic
1075006257 10:118832277-118832299 CAATGAAGCAGGGCGGGGTGGGG + Intergenic
1075380547 10:122015257-122015279 CACTTTAGGAGGCCGAGGTGGGG + Intronic
1075817262 10:125274237-125274259 CAAAGAAGGAGGTAGGGGAGAGG - Intergenic
1076311983 10:129515073-129515095 CACTGCAGGAAGCTGAGGAGCGG - Intronic
1076546321 10:131247809-131247831 CATGGCAGGAGGCAGGGGAGAGG - Intronic
1076797713 10:132806586-132806608 CGCTGGGGAAGGCCGGGGAGCGG - Intergenic
1076835939 10:133020937-133020959 CCCTGAAGGAGTCAGGAGAGGGG + Intergenic
1077081742 11:727415-727437 CCCTGAGGGGGGCCCGGGAGGGG + Exonic
1077362736 11:2147900-2147922 ACCTGAAGGAACCCGGGGAGGGG - Intronic
1077459957 11:2704077-2704099 CACTGAAGGGGACCGAGGAGGGG - Intronic
1077610930 11:3642658-3642680 CACTGAAGGCGAATGGGGAGAGG - Intergenic
1078136858 11:8658789-8658811 CACTGAAGGAGGGTGTGGGGGGG + Intronic
1078170176 11:8923858-8923880 CACTTTGGGAGGCCGGGGGGTGG - Intronic
1079060104 11:17241045-17241067 GAGTGAAGGAGGGAGGGGAGGGG - Intronic
1079244155 11:18740988-18741010 CACTGCAGGAGGCAGGAGATAGG - Intronic
1079995072 11:27287111-27287133 CACTTTAGGAGGCCGAGGCGGGG - Intergenic
1080771866 11:35349166-35349188 CACTGCGGGAGCCCGGGCAGGGG + Intronic
1081484380 11:43516417-43516439 CACTGGGGGAGACCGGGGTGTGG - Intergenic
1083357008 11:62074283-62074305 CACTGTAGGAGGCCAAGGTGGGG + Intergenic
1083563101 11:63690003-63690025 CACTGTGGGAGGCCGAGGCGGGG - Intronic
1084034903 11:66503639-66503661 CACTTTGGGAGGCCGGGGCGGGG + Intronic
1084111895 11:67019649-67019671 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1084226107 11:67715692-67715714 CACTGGAGGGGGCGGGGCAGGGG - Intergenic
1084952214 11:72672877-72672899 CACTGATGCAGGGCAGGGAGGGG - Intronic
1085110341 11:73882255-73882277 CACTTTGGGAGGCCAGGGAGCGG - Intronic
1086322573 11:85665415-85665437 CACTGAAGTACGCAGGGGTGTGG - Intronic
1086511682 11:87565323-87565345 CAATGAAGGGGGTGGGGGAGAGG - Intergenic
1087106774 11:94417220-94417242 CACTTTGGGAGGCCGAGGAGGGG - Exonic
1087557005 11:99733697-99733719 CTCTGATGGAGGGCGGTGAGGGG + Intronic
1088254482 11:107889882-107889904 CATTTTGGGAGGCCGGGGAGGGG - Intronic
1088738681 11:112749157-112749179 CCCTGCATGAGGCCAGGGAGAGG + Intergenic
1089051237 11:115547929-115547951 CAATGAAGGAGACTGAGGAGTGG + Intergenic
1089165809 11:116475597-116475619 CACGGCAGGGGGCGGGGGAGGGG + Intergenic
1089396140 11:118137216-118137238 CTCTGTAGAAGGCCAGGGAGAGG - Intronic
1089521738 11:119069003-119069025 CACTTTGGGAGGCCGGGGGGGGG - Intronic
1089937298 11:122377336-122377358 TGCTGAAGGAGGCGGGGGGGGGG + Intergenic
1090028211 11:123185517-123185539 CAGAGAAGGAGGCTGCGGAGAGG + Intronic
1091227306 11:133965231-133965253 CTGTGAAAGAGGCCGGGCAGCGG - Intergenic
1091876118 12:3934430-3934452 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1091916969 12:4276753-4276775 CACTGAAGGAGTCCGAGGCCTGG + Intronic
1093089578 12:14906114-14906136 CACTCTAGGAGGCCGAGGCGGGG - Intronic
1095266862 12:40170793-40170815 CACTCAAGCAGCCCGTGGAGAGG + Intergenic
1095926982 12:47588318-47588340 GACTGGAGGAGGCCAGGAAGTGG + Intergenic
1097188015 12:57205864-57205886 GACTGAAGGAGTCTGGGGTGTGG + Intronic
1097783093 12:63729911-63729933 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1097885593 12:64725749-64725771 CACTTTAGGAGGCCAAGGAGGGG + Intronic
1097918974 12:65051382-65051404 CACTTAAAAAGGCCGAGGAGCGG - Exonic
1098217322 12:68234286-68234308 CAATGATGAAGGCAGGGGAGGGG - Intergenic
1099858044 12:88193973-88193995 CACTTAGGGAGGCCAGGGTGGGG + Intronic
1101755815 12:107619944-107619966 CAGGGAAGGTGGCAGGGGAGGGG - Intronic
1101824927 12:108212738-108212760 CACAGAAGGGGGCAGGTGAGGGG - Intronic
1101935185 12:109051514-109051536 CACTTTGGGAGGCCGGGGGGTGG - Intronic
1102496290 12:113321347-113321369 CACTGCAGGAAGACAGGGAGGGG + Exonic
1102953692 12:117046268-117046290 CACTGACTGAGGCCGGGGTGGGG + Intronic
1103075953 12:117982700-117982722 CACTTTGGGAGGCCGGGGGGAGG + Intergenic
1103309127 12:119990050-119990072 CGCTGCTGGCGGCCGGGGAGCGG + Exonic
1104032857 12:125077953-125077975 CACTTTAGGAGGCCGAGGCGGGG - Intronic
1104316355 12:127706136-127706158 CACAGAAGGAACCCGGGGAGGGG - Intergenic
1104788119 12:131464214-131464236 CACTGAAGGCAGGCAGGGAGAGG + Intergenic
1106561102 13:30846982-30847004 CTCTGCAGGAGGACGGGGAAGGG + Intergenic
1107467938 13:40666267-40666289 CACTGGGGGCGGACGGGGAGGGG + Exonic
1111651281 13:91093651-91093673 CACTTTAGGAGGCCGAGGCGGGG - Intergenic
1111661916 13:91222449-91222471 CACTGAAGGAGCTGAGGGAGTGG - Intergenic
1112365951 13:98755630-98755652 CAGTGAAGAAAGCCGGGGAAGGG - Intergenic
1113238578 13:108311579-108311601 CACTGAAGAAGGGCATGGAGAGG + Intergenic
1113511319 13:110856953-110856975 CACTCAAGCAGCCCTGGGAGAGG - Intergenic
1113868396 13:113543491-113543513 CACAGATGGAGGGCGGGGGGAGG - Intronic
1113990541 14:16024314-16024336 CACTGAAGAACGCGGGGGAGGGG + Intergenic
1114012382 14:18383504-18383526 CACTTTGGGAGGCCGGGGTGGGG + Intergenic
1114214207 14:20643614-20643636 CACTTTGGGAGGCCGAGGAGAGG - Intergenic
1114239031 14:20849037-20849059 GACAGAGGGCGGCCGGGGAGAGG + Intergenic
1114263329 14:21055557-21055579 CACTCAGGGAGGCCTGGGAATGG - Intronic
1114455108 14:22848986-22849008 CAGTGGAGGAGCCTGGGGAGGGG + Intronic
1114461222 14:22887152-22887174 ACCTGAAGGCGGCCGGTGAGCGG + Exonic
1116785333 14:49281579-49281601 CACTTTGGGAGGCCGGGGGGCGG - Intergenic
1116947560 14:50849635-50849657 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
1116973949 14:51095326-51095348 CTCTGAAGGGGGCCGGCGTGCGG + Exonic
1117342869 14:54806725-54806747 CACTTTAGGAGGCCGAGGAGGGG + Intergenic
1117970061 14:61242641-61242663 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1118084560 14:62399601-62399623 CACTGAAAGAGGCACTGGAGAGG - Intergenic
1118628575 14:67681535-67681557 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1118840573 14:69507133-69507155 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1119728975 14:76939145-76939167 AACTAAAGTAGGCTGGGGAGGGG + Intergenic
1122608992 14:102968692-102968714 GAAGCAAGGAGGCCGGGGAGCGG - Exonic
1122703948 14:103608488-103608510 CACTGTAGCAGGCTGGGGATGGG - Intronic
1123151494 14:106185964-106185986 AGGTGAAGGAGGCTGGGGAGGGG - Intergenic
1123435092 15:20248564-20248586 CCCTGAAGAGGGCCTGGGAGAGG - Intergenic
1123889303 15:24759777-24759799 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1124117080 15:26854707-26854729 CACTCAAGGTGGGAGGGGAGGGG - Intronic
1124217992 15:27825454-27825476 CACTGAGGGAGGCAGGGAAGCGG + Intronic
1124376265 15:29130936-29130958 TACAGAAGGAGAGCGGGGAGAGG + Intronic
1124443857 15:29710910-29710932 CAATGGAGGAGGAGGGGGAGTGG + Exonic
1124453615 15:29821781-29821803 CACTGGGGGCGGCCGGGGAGGGG - Intronic
1125665439 15:41426712-41426734 CACTTCAGGAGGCCGGCGGGGGG - Intronic
1125833736 15:42733518-42733540 CACTTCAGGAGGCCGAGGGGCGG - Intronic
1125933579 15:43616604-43616626 CAGTGAAGGAGGGCAGGGGGTGG + Exonic
1125946677 15:43716066-43716088 CAGTGAAGGAGGGCAGGGGGTGG + Intergenic
1126193160 15:45900128-45900150 CACTGAGGGTGGCTGGCGAGTGG + Intergenic
1127503293 15:59574789-59574811 CACTCTGGGAGGCCGAGGAGGGG - Intergenic
1128427682 15:67558796-67558818 GACTGAAGGAGGTGAGGGAGTGG - Intronic
1128488190 15:68118079-68118101 CACTTTGGGAGGCCGAGGAGCGG + Intronic
1128618321 15:69127829-69127851 CAGTGCAGGGGGCAGGGGAGGGG - Intergenic
1128941390 15:71790613-71790635 CACTGAGGTGGGCCGGGTAGTGG - Intergenic
1128984929 15:72212824-72212846 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1130048070 15:80461426-80461448 GAATGGAGGAGGCCGGGGACGGG + Intronic
1130399001 15:83531512-83531534 CAATGAATGAGGCTGGAGAGAGG + Intronic
1132554631 16:567086-567108 CACCGAGAGAGGCCGGGGGGAGG - Intronic
1132795337 16:1718427-1718449 CACTTTAGGAGGCCGAGGTGGGG - Intronic
1132856487 16:2047391-2047413 CACTGCAGGAGGGCGGGGATGGG + Intronic
1133181149 16:4055586-4055608 CACTTTGGGAGGCCGGGGTGGGG + Intronic
1133230151 16:4362538-4362560 CACAGGAGGATGACGGGGAGTGG + Intronic
1133393787 16:5429971-5429993 CACTGAAGGAGGCAGAGAGGAGG + Intergenic
1134111180 16:11516306-11516328 CACTGCAGGAGGGCGGACAGGGG + Exonic
1134509002 16:14831345-14831367 AGCTGAAGGGGGCAGGGGAGGGG - Intronic
1134696703 16:16230179-16230201 AGCTGAAGGGGGCAGGGGAGGGG - Intergenic
1134853666 16:17502139-17502161 AACTGAAAAAGGCCAGGGAGTGG - Intergenic
1134975130 16:18564526-18564548 AGCTGAAGGGGGCAGGGGAGGGG + Intergenic
1135128204 16:19829234-19829256 CACTGAGGGAGGATGGGGACAGG - Intronic
1135634886 16:24067095-24067117 CACTTTAGGAGGCTGAGGAGGGG - Intronic
1135936466 16:26784777-26784799 CACTTTAGGAGGCCGAGGTGGGG - Intergenic
1136044184 16:27602386-27602408 GACTGAACAAGGCAGGGGAGTGG - Intronic
1136072414 16:27795833-27795855 CACTGAGGGAGGCGGGAGATGGG - Intronic
1136092002 16:27927399-27927421 CACTGAAGGATTCCGGCGAGAGG - Intronic
1136398732 16:30006553-30006575 CATGGAGGGAGGCCAGGGAGGGG - Intronic
1136584479 16:31175115-31175137 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1136849509 16:33602385-33602407 CCCTGAAGAGGGCCCGGGAGAGG + Intergenic
1136909691 16:34135394-34135416 CACTGAAGAACGCGGGGGCGGGG + Intergenic
1137593541 16:49708631-49708653 CAGTGGAGGATGTCGGGGAGGGG - Intronic
1137725002 16:50651042-50651064 CTCTGCAGGAGGCCCAGGAGGGG - Intergenic
1138061697 16:53898181-53898203 CACTGATGGAGGTCGAGGAATGG - Intronic
1139364502 16:66425674-66425696 GCCTGCAGGAGGGCGGGGAGTGG + Intergenic
1139778439 16:69331200-69331222 CACTTTGGGAGGCCGGGGAGGGG + Intronic
1140389726 16:74574993-74575015 CACTTTGGGAGGCCGGGGGGGGG + Intronic
1140511183 16:75509578-75509600 CACAGCAGGAGTCCGGGGTGTGG - Intergenic
1140914706 16:79483182-79483204 GACAGAAGGAGGGAGGGGAGGGG - Intergenic
1140932443 16:79640279-79640301 CACTTTAGGAGGCCGAGGCGGGG + Intergenic
1141169461 16:81681961-81681983 CACTTTAGGAGGCCGAGGCGGGG + Intronic
1142110328 16:88327682-88327704 CACGGAAGGTGGGAGGGGAGAGG - Intergenic
1142285160 16:89168667-89168689 GGCTGGAGGAGGCCGGGGTGAGG - Intergenic
1142375072 16:89702303-89702325 AAGTGCAGGAGGCCGGGAAGCGG - Intergenic
1203111218 16_KI270728v1_random:1451038-1451060 CCCTGAAGAGGGCCCGGGAGAGG + Intergenic
1142569679 17:865128-865150 CACTGAAGGAGCACAGGGAGGGG - Intronic
1142735977 17:1899910-1899932 CATAAAAGGTGGCCGGGGAGTGG - Intronic
1143208815 17:5167747-5167769 CACTTTAGGAGGCCGAGGTGGGG - Intronic
1143345184 17:6244026-6244048 CACTGGAGGAGGGATGGGAGGGG + Intergenic
1143641501 17:8200874-8200896 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1144727582 17:17509602-17509624 CACTGAGGGAGGCCCCAGAGCGG + Intronic
1144967918 17:19089433-19089455 GCCGGAAGGAGGCGGGGGAGGGG - Intergenic
1144979999 17:19162630-19162652 GCCGGAAGGAGGCGGGGGAGGGG + Intergenic
1144988223 17:19215602-19215624 GCCGGAAGGAGGCGGGGGAGGGG - Intronic
1145190580 17:20840703-20840725 CGGTGCAGGAGGCCGGGCAGGGG + Intronic
1145312760 17:21709364-21709386 CTATGGTGGAGGCCGGGGAGGGG - Intergenic
1145847087 17:28049735-28049757 CACTTTGGGAGGCCGAGGAGCGG + Intronic
1146700386 17:34953573-34953595 CACTTTAGGAGGCCGAGGTGGGG - Intronic
1147163217 17:38579586-38579608 GACTGAAGAAGGGAGGGGAGAGG - Intronic
1147935271 17:44007302-44007324 CCCTGGAGGAGGATGGGGAGGGG - Exonic
1148162273 17:45457315-45457337 CACTTTAGGAGGCCGAGGCGGGG + Intronic
1148558666 17:48593490-48593512 GGCTGGAGGAGGCCGAGGAGCGG + Exonic
1149848099 17:60019049-60019071 CACTGAGGCAGGCCAGAGAGCGG + Intergenic
1149871477 17:60185814-60185836 CACTTTAGGAGGCCGAGGTGGGG + Intronic
1150086455 17:62275652-62275674 CACTGAGGCAGGCCAGAGAGCGG + Intronic
1150529620 17:65963258-65963280 CACTGAAGGATGCTGGGCGGGGG + Intronic
1150796988 17:68246954-68246976 CACTGTGGGAGACCGGGGTGCGG + Intergenic
1151351811 17:73536409-73536431 CTCGGAAGGAGGCTGGAGAGGGG - Intronic
1151372900 17:73660239-73660261 CACTGAAACAGGCAGTGGAGGGG - Intergenic
1151514230 17:74581753-74581775 GACTGAAGGTGGCAGGAGAGGGG - Intronic
1152093293 17:78258530-78258552 CTCTCAAGAAGGCCAGGGAGGGG - Intergenic
1152125824 17:78445922-78445944 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1153808990 18:8735281-8735303 AACTGAAGGTGGCAGAGGAGTGG - Intronic
1153932206 18:9887864-9887886 CACTGAAGGAGGCCGGGGAGAGG + Exonic
1154213830 18:12401068-12401090 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1155164114 18:23218860-23218882 CCCTGATGGAGGCTGGGGAAGGG + Intronic
1155352165 18:24917574-24917596 CACGGGAGGAGGCAGGGCAGGGG + Intergenic
1156312817 18:35940468-35940490 CACTGTAGTAGGCCGAGGCGGGG - Intergenic
1156372156 18:36481161-36481183 GACTGAAGGAAGGAGGGGAGCGG + Intronic
1157140001 18:45096095-45096117 CACTTTGGGAGGCCGGGGCGGGG - Intergenic
1157444121 18:47732026-47732048 AACTGATAGGGGCCGGGGAGTGG - Intergenic
1158461270 18:57648229-57648251 CACTTTAGGAGGCTGAGGAGGGG - Exonic
1158483004 18:57838314-57838336 CACTGAAGGAGGCTAGGTATAGG + Intergenic
1158884960 18:61818175-61818197 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1159823221 18:73173083-73173105 CGGTGAAGGAGGCGGGAGAGGGG + Intronic
1159856828 18:73598897-73598919 CACGGAAGGGGGCCGGGGTGGGG - Intergenic
1160278231 18:77459790-77459812 CACTGAAGGAGAAAGGGGAAAGG - Intergenic
1160298826 18:77660465-77660487 CACTGAAGGAGGCACTGAAGAGG + Intergenic
1160996735 19:1885435-1885457 CGGTGCAGGAGGCCGGGCAGGGG - Intronic
1161343558 19:3755546-3755568 CACTTTAGGAGGCCGGGGGGGGG + Intronic
1161430467 19:4229413-4229435 ACCTGAAGGAAGTCGGGGAGGGG + Intergenic
1161649351 19:5474781-5474803 CACGGAGGGAGGGAGGGGAGGGG + Intergenic
1162417736 19:10548276-10548298 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1162427174 19:10603472-10603494 CACTGAAGGGCCCTGGGGAGGGG + Intronic
1162435301 19:10654533-10654555 CACTGAGGGCGGGCGGGGGGAGG - Intronic
1162437709 19:10672297-10672319 CACTGTGGGAGGCTGGGGACAGG - Intronic
1162562369 19:11424077-11424099 TTGGGAAGGAGGCCGGGGAGGGG + Intronic
1162812495 19:13172680-13172702 CACTGAAAGAGGGCGGGTAGAGG - Intergenic
1163140322 19:15343561-15343583 CACTTTAGGAGGCCGAGGACGGG + Intergenic
1163790045 19:19301301-19301323 CAGTGAATGGGGACGGGGAGAGG - Intronic
1164472914 19:28550685-28550707 CACTAAAGGACACCGGGGAGAGG - Intergenic
1164616650 19:29670917-29670939 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1164630936 19:29761060-29761082 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1165031243 19:32999485-32999507 CCCTGAAGAGGGCCCGGGAGAGG - Intronic
1165227684 19:34365958-34365980 TACTGGTGGAGGCGGGGGAGGGG + Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165284884 19:34833282-34833304 CCTGGAAGGGGGCCGGGGAGAGG - Intergenic
1165493680 19:36140096-36140118 CGCTGCGGGAGGCCCGGGAGCGG + Exonic
1165766160 19:38352488-38352510 CACTGAAGGTGGCTGGGGGCTGG + Intronic
1166408484 19:42540519-42540541 CACTGAAGAGGGCCGGAGAGAGG - Intronic
1167107177 19:47437099-47437121 AACTGAAATGGGCCGGGGAGAGG - Intronic
1167164123 19:47786640-47786662 CACTTTAGGAGGCCGAGGCGGGG - Intergenic
1167295310 19:48646089-48646111 CACTGAGGGAGGGCGGGAGGAGG - Exonic
1167342706 19:48925341-48925363 CACTGTGGGAGGCCGAGGCGGGG - Intergenic
1167425415 19:49427599-49427621 GAGTGAAGGAGACCGGTGAGGGG + Exonic
1167461608 19:49627557-49627579 CACTGTGGGAGGCCGGGGCGGGG + Intergenic
1167640265 19:50677896-50677918 GGCTGAAGGAGGTGGGGGAGGGG - Intronic
925466425 2:4110728-4110750 CACGGAAGGAGGGCAGGGAATGG - Intergenic
925880010 2:8344832-8344854 CAGTGAAGGAGCCCTGTGAGTGG - Intergenic
926321324 2:11750085-11750107 CAGGGAGCGAGGCCGGGGAGGGG - Intronic
927510562 2:23641490-23641512 CTCTGAGGGAGGCAGGGGAAGGG - Intronic
927717798 2:25363810-25363832 CACTTAAGGAGGTCGAGGGGTGG - Intergenic
927860708 2:26558414-26558436 CTCTGGAGGTGGCCGGGGATAGG - Intronic
927906150 2:26858817-26858839 CACTGTAGGAGGCCAAGGCGGGG - Intronic
928016957 2:27666375-27666397 CACTTTGGGAGGCCGGGGGGCGG - Intronic
928242988 2:29602637-29602659 CCCTGAGGGAGGCAGGTGAGGGG - Intronic
929599021 2:43193548-43193570 GGCTGAAGCAGGGCGGGGAGAGG - Intergenic
929829365 2:45334755-45334777 CACAGAATGGGGCTGGGGAGGGG - Intergenic
930199360 2:48538200-48538222 CACTTTGGGAGGCCGAGGAGGGG - Intronic
930825482 2:55693183-55693205 GGCTGAAGGAGCCCGAGGAGTGG + Intronic
930900850 2:56506311-56506333 CCCTGAAGTAGGCCTGGGACTGG + Intergenic
931483508 2:62667498-62667520 CACTGTGGGAGGCCGAGTAGGGG + Intergenic
933756228 2:85640716-85640738 CACTGTAGGAGGCCGAGGCAGGG - Intronic
934980706 2:98837296-98837318 CAGGCAAGGAGGCTGGGGAGGGG + Intronic
935093301 2:99917377-99917399 CACTAAGGGAGATCGGGGAGTGG + Intronic
935191113 2:100779586-100779608 CACTGGAGGGGGGCGGGGGGCGG - Intergenic
935731413 2:106067046-106067068 CACTTTGGGAGGCCGGGGGGGGG + Intronic
935754209 2:106264563-106264585 CACTTTAGGAGGCCGAGGAAAGG + Intergenic
935979371 2:108611632-108611654 CTCTGTGGGAGGCCGGGGCGTGG + Intronic
936521441 2:113214340-113214362 GACTGAGGGAGGCCGCGGGGAGG - Intergenic
936882732 2:117274116-117274138 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
936976293 2:118224980-118225002 CTCTGGAGGAGGTCGGGGTGGGG + Intergenic
937367056 2:121270755-121270777 CACTTTAGGAGGCTGAGGAGGGG + Intronic
937706914 2:124931676-124931698 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
938365756 2:130732424-130732446 CACTTTGGGAGGCCGGGGCGGGG + Intergenic
938734822 2:134176325-134176347 CACTTTGGGAGGCCGGGGTGGGG + Intronic
940463889 2:154003815-154003837 CACAGAAGGAGGAAGAGGAGGGG - Intronic
940725367 2:157330381-157330403 CAATGTTGGAGGCAGGGGAGGGG + Intergenic
941746114 2:169088412-169088434 CACTGAAAGAGGCCCTGAAGAGG - Intronic
942246521 2:174013287-174013309 CCCTGAGGGTCGCCGGGGAGAGG - Intergenic
942302056 2:174571992-174572014 CACTGGAGGAGGTGGTGGAGGGG + Exonic
942355942 2:175110089-175110111 CACTTTGGGAGGCTGGGGAGGGG + Intronic
942556253 2:177175251-177175273 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
944252709 2:197593641-197593663 CACTGTGGGAGGCCGAGGTGGGG + Intronic
944576873 2:201098535-201098557 CACTTTGGGAGGCCGGGGTGAGG + Intergenic
944659253 2:201907214-201907236 CACTGTTGCAGGCCGGGGATTGG + Intergenic
945090814 2:206174042-206174064 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
945274249 2:207972332-207972354 CACTTTGGGAGGCCGGGGGGCGG + Intronic
945311441 2:208318150-208318172 GACAGAAGGAGGAAGGGGAGAGG + Intronic
945960973 2:216134679-216134701 CACTTTGGGAGGCCGAGGAGGGG - Intronic
946737164 2:222765339-222765361 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
946748651 2:222870972-222870994 CATTGATGGAGGAGGGGGAGAGG + Intronic
947009293 2:225547729-225547751 CACTGAAGGAGGCACTGAAGAGG - Intronic
947085908 2:226452607-226452629 AACTGAAGGAGGAGGGGAAGAGG + Intergenic
947583022 2:231333374-231333396 GACTGATGGAGGCTGGGGGGCGG + Intronic
947715236 2:232335916-232335938 CACCGCAGGAGGCAGGAGAGGGG - Intronic
947739442 2:232478484-232478506 AACTGCAGGAGCCCGGGGTGAGG + Intergenic
948000285 2:234562175-234562197 CATGGAAGGAGACCGTGGAGAGG - Intergenic
948045905 2:234944964-234944986 CACTTAAGGAGGCCAAGGGGAGG - Intergenic
948771315 2:240252617-240252639 CACTGAAGGAGACCGAGGTGGGG + Intergenic
948903588 2:240967739-240967761 AACTGCAGGAGGCCAGGGTGGGG - Intronic
1168850547 20:973752-973774 CACTCTATGAGGCCTGGGAGGGG - Intronic
1168911305 20:1449378-1449400 CTCTCAAGGAGGATGGGGAGTGG + Intronic
1168933982 20:1647222-1647244 CAGGGAAGGGGGCCAGGGAGTGG - Intronic
1169651828 20:7877427-7877449 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
1170815176 20:19708039-19708061 CACTGAAGGAGACTGAGGAAGGG + Intronic
1171996509 20:31735819-31735841 CACTTCAGGAGGCCGGGGGTGGG - Intergenic
1172245735 20:33443816-33443838 AAATGCAGGAGGCCGGGGCGGGG + Exonic
1172296051 20:33811800-33811822 CATTGAAGGGAGTCGGGGAGGGG - Intronic
1172621282 20:36320027-36320049 CACAGAGGGAGGCCTGGGAGAGG - Intronic
1172621314 20:36320135-36320157 CACAGAGGGGGGCCTGGGAGAGG - Intronic
1172692927 20:36803072-36803094 CAGGGAAGGGGGCCGGGGAGCGG - Exonic
1173018027 20:39244474-39244496 CACAGAAGGAGTCAGGAGAGGGG - Intergenic
1173826792 20:46052936-46052958 CTCTGAGGGAGGCCAAGGAGAGG - Exonic
1175220568 20:57414332-57414354 CCCTGAAGGAGGCATGGGTGGGG - Intergenic
1175222931 20:57427719-57427741 AAGTCAAGCAGGCCGGGGAGAGG - Intergenic
1175272913 20:57747256-57747278 CTTTGAGGGAGGCCGGAGAGAGG + Intergenic
1176064940 20:63189370-63189392 CTCTGCAGTAGGCAGGGGAGAGG + Intergenic
1176083135 20:63284003-63284025 CACGGACCGAGGCCAGGGAGAGG - Intronic
1176148422 20:63575824-63575846 CACTCAAGGAGGCCGAGGTGGGG - Intergenic
1177629838 21:23712137-23712159 CACTGTGGGAGGCAGGGTAGTGG - Intergenic
1178441484 21:32602163-32602185 CTCTGCAGAATGCCGGGGAGGGG - Intronic
1178488415 21:33033115-33033137 CACCTAAGGGGGCCGGGGTGGGG - Intergenic
1179047120 21:37855966-37855988 CACAGCAGAAGGCAGGGGAGAGG + Intronic
1179410593 21:41159965-41159987 CAGTGAAGGAGGGAGGGAAGGGG - Intergenic
1179572328 21:42285008-42285030 CAGCGAAGGGGGCTGGGGAGTGG + Intronic
1179663009 21:42890289-42890311 CACTTTAGGAGGCCGAGGTGGGG + Intronic
1179874587 21:44261627-44261649 CACTGTAGGAGGCTGGGGCATGG - Intronic
1179973432 21:44849145-44849167 CACAGAAGGGGGCCGGGGTGGGG + Intergenic
1180289194 22:10781429-10781451 CACTTTGGGAGGCCGGGGGGGGG + Intergenic
1180316729 22:11283212-11283234 CACTGAAGAACGCGGGGGAGGGG - Intergenic
1180436875 22:15314313-15314335 CACTTTGGGAGGCCGGGGTGGGG + Intergenic
1180519115 22:16178501-16178523 CACTTTGGGAGGCCGGGGTGGGG + Intergenic
1180651198 22:17378529-17378551 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1180801162 22:18632593-18632615 TACAGTAGGAGGCTGGGGAGAGG - Intergenic
1180846649 22:18986479-18986501 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1180852391 22:19028152-19028174 TACAGTAGGAGGCTGGGGAGAGG - Intergenic
1180938633 22:19642233-19642255 CACTGCAGGATGGCGTGGAGCGG - Intergenic
1181098716 22:20524396-20524418 CACTGATGGAGGACAGGGAAGGG + Intronic
1181113079 22:20613175-20613197 CTCTGGAGGAGGTGGGGGAGTGG + Intergenic
1181220559 22:21362668-21362690 TACAGTAGGAGGCTGGGGAGAGG + Intergenic
1181307796 22:21926878-21926900 CACTGCGGGAGGCCTGGGGGAGG + Intronic
1182184189 22:28384893-28384915 CACTTTGGGAGGCCGGGGACGGG + Intronic
1182275635 22:29186862-29186884 CACTTTAGGAGGCTGAGGAGTGG + Intergenic
1182286916 22:29254155-29254177 CCGTGAAGGGGGCAGGGGAGGGG - Intronic
1182489924 22:30664766-30664788 CTCTGAAGAAGGCCTGGGAAAGG + Intronic
1182875634 22:33688913-33688935 CACTGAAGGAGGTTCAGGAGTGG - Intronic
1183009130 22:34930412-34930434 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1183043571 22:35201886-35201908 GAGTGAAGGAGGCCTGAGAGAGG + Intergenic
1183344104 22:37297505-37297527 CATGGAAGCAGGCCTGGGAGGGG - Intronic
1183369537 22:37424668-37424690 CACTGAGGGCGGCGGGGGGGGGG + Intronic
1183458194 22:37934040-37934062 CTCTGCAGGAGGCTGGGGCGTGG + Intronic
1183893824 22:40951600-40951622 CACGAAAGGAAGCCGGGGGGCGG + Intronic
1184248196 22:43246191-43246213 AAGTGAAGGAGGCAGGGCAGGGG - Intronic
1184616813 22:45644009-45644031 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1184650673 22:45918216-45918238 CTCTGCAGGGGGACGGGGAGGGG + Intergenic
1184985191 22:48127560-48127582 GACTGAAGAAGGGCCGGGAGGGG + Intergenic
1185148013 22:49149774-49149796 AAGGGAAGGAGGCTGGGGAGGGG + Intergenic
1185293044 22:50036841-50036863 CAGTTAAGGAGGCCGAGGCGGGG - Intronic
1185376170 22:50483526-50483548 CCCTGTAGGAGGCCAGGGAGGGG + Exonic
1185378811 22:50496827-50496849 CACTGTGGGAGGCCGAGGTGAGG + Intergenic
950138883 3:10601681-10601703 CAGGGAAGGACCCCGGGGAGGGG + Intronic
950161858 3:10766182-10766204 CACTGAAGGGGTCAGGTGAGGGG + Intergenic
951697232 3:25457874-25457896 CACAGAAGGAAGGTGGGGAGCGG - Intronic
953552353 3:43913318-43913340 CAACAAAGGAGGCTGGGGAGTGG + Intergenic
953834205 3:46329055-46329077 AACTGAAGGAGCCGGGGGAGGGG + Intergenic
954479867 3:50788786-50788808 CAGGGAGGGAGGCAGGGGAGGGG + Intronic
954857970 3:53663159-53663181 CACAGGAGGAGGCAGGGGAGAGG - Intronic
955185357 3:56709984-56710006 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
955660636 3:61295255-61295277 CACTGTGGGAGGCCGAGGCGGGG - Intergenic
955735785 3:62036940-62036962 CACTGAGGGAGGTAGGGAAGTGG - Intronic
956194460 3:66638271-66638293 CACTGTAGGAGGCCAAGGGGGGG - Intergenic
958178143 3:90023016-90023038 CACTGAAGCAGCCCATGGAGAGG + Intergenic
958930510 3:100202946-100202968 CACTTTGGGAGGCCGGGGAGAGG + Intergenic
960950784 3:122997298-122997320 AACTGAAGGAGGCTGAGGAGAGG - Intronic
961645953 3:128392896-128392918 CACTGAAGGAGGTCTGGGGAGGG - Intronic
961796711 3:129414373-129414395 CCCTGGAGGAGGCAGTGGAGGGG - Intronic
962415519 3:135178206-135178228 CACTTTGGGAGGCCGGGGAGGGG + Intronic
962881553 3:139581947-139581969 CACTTTGGGAGGCCGGGGTGGGG + Intronic
964381638 3:156103620-156103642 CACTGGAGGAGGCTGGGGAAGGG - Intronic
965606008 3:170498110-170498132 CAATAAAGGAGGCCAGGGAAAGG - Intronic
965618926 3:170622968-170622990 CACTGAAGCAGGGGAGGGAGGGG + Intronic
965686054 3:171303992-171304014 CACTGAAGAAGGCCCGGGGGAGG + Intronic
966136222 3:176701439-176701461 CACTCAAGTAGCCCGTGGAGAGG + Intergenic
967296218 3:187967697-187967719 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
967859469 3:194140825-194140847 CACTGCTGGGGGCCGGCGAGAGG - Intergenic
968062383 3:195735478-195735500 AAATTAAGGAGGCAGGGGAGGGG - Intronic
968182754 3:196609425-196609447 CACTGTTGGATCCCGGGGAGAGG - Intergenic
968482165 4:838334-838356 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
968565356 4:1309718-1309740 GCATGAAGGAGGCCGGGGAGGGG - Intronic
968660911 4:1798350-1798372 CCCTCAAGGGGGCCGGGGGGTGG - Intronic
968704281 4:2070824-2070846 CACTGCAGGAGGCCGGCCAGGGG - Intergenic
968705611 4:2076071-2076093 CCATGAAGGAGGCTGGGGAAGGG - Intronic
968725033 4:2242814-2242836 CACTTTGGGAGGCCGGGGGGGGG + Intergenic
968865743 4:3210097-3210119 CTCTGAATGGGGCCGGGAAGTGG + Intronic
969834442 4:9828743-9828765 CAATGAAGCAGGGCTGGGAGGGG - Intronic
972148685 4:36062315-36062337 CACTGAAGGAGGCACTGAAGGGG - Intronic
972483477 4:39520091-39520113 CACTTTGGGAGGCCGAGGAGGGG + Intronic
972621510 4:40751501-40751523 CAGTGAGGGAGGATGGGGAGAGG + Intronic
972792074 4:42382567-42382589 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
972983111 4:44729094-44729116 CACTATAGGAGGCTGAGGAGGGG - Intergenic
973842149 4:54873321-54873343 CACAGAAGCAGACTGGGGAGGGG - Intergenic
974064947 4:57069097-57069119 CCTAGAAGGAGGCCTGGGAGGGG - Intronic
975923069 4:79416365-79416387 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
976082960 4:81376146-81376168 CACTGAAAGAGGCAGTGAAGTGG - Intergenic
976947016 4:90782923-90782945 CACTTCGGGAGGCCGAGGAGGGG - Intronic
980070072 4:128234617-128234639 CACTTTAGGAGGCCGAGGTGGGG - Intergenic
980725691 4:136757606-136757628 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
980969754 4:139557016-139557038 ACCCGAAGGAGGGCGGGGAGTGG - Intronic
981338821 4:143596687-143596709 CACTTTGGGAGGCCGAGGAGAGG + Intronic
982088978 4:151864138-151864160 CACTGAGGGAGGCTGTGGATTGG - Intergenic
982746116 4:159104604-159104626 CACGGAGGGCGGCTGGGGAGAGG - Intronic
983085690 4:163441728-163441750 CACTGATAGAGGCTGTGGAGAGG + Intergenic
983269407 4:165543815-165543837 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
983492985 4:168411299-168411321 CACTGAAGGAGGCACTGAAGAGG + Intronic
984898147 4:184560366-184560388 CACTTAGGGAGGCCGAGGCGGGG + Intergenic
985259689 4:188103570-188103592 CACTGAAGGAGGTGGGGGATTGG - Intronic
985593610 5:777892-777914 CACCGAGGGAGCCCGGGGCGGGG + Intergenic
985817201 5:2135736-2135758 CAGTGGAGGGGGCCGGGGAGAGG + Intergenic
986631326 5:9776363-9776385 CACTGAAGGAGGCACTGAAGAGG - Intergenic
987834619 5:23145772-23145794 CACTCAAAGAGGCTGGAGAGCGG + Intergenic
989588169 5:43089105-43089127 CGTGGAAGGAGACCGGGGAGAGG + Intronic
991306491 5:65181873-65181895 ATGTGAAGGAGGCAGGGGAGTGG - Intronic
991617602 5:68513332-68513354 CACTTTGGGAGGCCGGGGCGGGG + Intergenic
992401940 5:76419581-76419603 CACTTTAGGAGGCCGAGGTGGGG - Intronic
992913737 5:81425917-81425939 CACAGAAGGAGGCCTGGGAAGGG - Intronic
995845564 5:116490345-116490367 CACTGTAGGAGGCCAAGGCGGGG - Intronic
996405445 5:123098841-123098863 CACTGAAGCAGGGCGGGGACAGG - Intronic
997596256 5:135109153-135109175 CAATGCAGGAGGCCAGGCAGGGG + Intronic
998160136 5:139808622-139808644 CTCTGATGGGGGCCCGGGAGTGG + Intronic
999086212 5:148892600-148892622 CACTCAAGGAGGCCAGAGAAAGG + Intergenic
999267669 5:150277403-150277425 CACTGATGGGGGCCAGCGAGGGG + Intronic
999319791 5:150606812-150606834 CACTGAAAGAGGCGGCTGAGGGG - Intronic
999993493 5:157069890-157069912 CACTTTAGGAGGTCAGGGAGGGG - Intergenic
1000207187 5:159073664-159073686 CAAAGAAGGAGGTGGGGGAGAGG + Intronic
1001628636 5:173158174-173158196 CACTTTAGGAGGCCGAGGTGGGG - Intronic
1003846652 6:10181151-10181173 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1005901435 6:30220103-30220125 CACTTTGGGAGGCCGGGGTGGGG - Intergenic
1006839991 6:37022490-37022512 CACAGATGGAGGCCGAGGTGGGG - Intronic
1007728397 6:43930850-43930872 CCCTGAAGGAGACATGGGAGGGG + Intergenic
1010146338 6:72673635-72673657 CAAGGAAGGAGGACGTGGAGTGG + Intronic
1010382528 6:75241698-75241720 CACTTTGGGAGGCCGGGGAGGGG + Intronic
1010746091 6:79563355-79563377 CACTTCAGGAGGCCGAGGCGGGG - Intergenic
1010980219 6:82363567-82363589 CACCCAAGGATGTCGGGGAGGGG + Intronic
1010991607 6:82485736-82485758 CACTGCAGGAGGCTAGGGGGTGG - Intergenic
1011217213 6:85017849-85017871 CACTCAAGCAGTCCTGGGAGAGG + Intergenic
1011655768 6:89550708-89550730 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1011773230 6:90698313-90698335 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1012078429 6:94725429-94725451 CACAGAAAGAGGAAGGGGAGAGG + Intergenic
1013013326 6:106139477-106139499 CACTTAGGGAGGCCGAGGGGGGG - Intergenic
1013619314 6:111873006-111873028 CGCCGGAGGAGGGCGGGGAGAGG - Exonic
1015136921 6:129882806-129882828 CACTCAAGGAGGCTGGAGAGCGG + Intergenic
1016056090 6:139579205-139579227 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1017078186 6:150639597-150639619 CAATGAAGCAGGCAGGTGAGTGG + Intronic
1018336695 6:162798660-162798682 CACTAAAGGAGGCTGTGAAGTGG + Intronic
1018485486 6:164237487-164237509 CACTGAAGGAGGCAGAGGTGGGG + Intergenic
1018774444 6:166999739-166999761 CACGGAATGAGGCAGGGGATGGG - Intronic
1019039798 6:169094382-169094404 CCCAGATGGAGGCCGGGAAGAGG - Intergenic
1019315081 7:380555-380577 GACAGAGGGAGGCAGGGGAGGGG + Intergenic
1019767875 7:2864758-2864780 CACTTCAGGAGGCCGAGGCGGGG - Intergenic
1020007418 7:4789993-4790015 CACTGAAGGGGAGGGGGGAGGGG - Intronic
1021405260 7:20260382-20260404 CACTGATGCAGGCAGGAGAGAGG - Intergenic
1022398037 7:30008473-30008495 CACTGTGGGAGGCCGAGGTGGGG + Intergenic
1023745574 7:43319533-43319555 CAAGGAAGGAGGCCGGCGGGTGG - Intronic
1023773573 7:43582951-43582973 CACGGAGTGAGGCCGGGGCGGGG + Intronic
1026038578 7:66847019-66847041 CACGGCAGGGGGGCGGGGAGGGG - Intergenic
1026190042 7:68117390-68117412 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1027242468 7:76341044-76341066 CACTTTAGGGGGCTGGGGAGGGG - Intronic
1028334792 7:89638510-89638532 CACTTTAGGAGGCCGAGGTGGGG - Intergenic
1029707909 7:102285365-102285387 CTATGAATGAGGCCGGGAAGGGG - Intronic
1030984243 7:116222359-116222381 CACTGAAGGAGGCTGCCCAGAGG - Intronic
1032864421 7:135911647-135911669 CACTTTAGGAGGCCGAGGCGGGG + Intergenic
1032870305 7:135977538-135977560 GAATGAAGGAGGCCCGGGGGAGG + Intergenic
1032936182 7:136734381-136734403 CACTTTAGGAGGCCAAGGAGGGG + Intergenic
1033254677 7:139789874-139789896 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1033325366 7:140373199-140373221 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1033640471 7:143258763-143258785 CATTGGAGGAGGCAGAGGAGAGG - Intronic
1034221644 7:149451060-149451082 CACAGATGGAGCGCGGGGAGCGG - Exonic
1034447613 7:151121582-151121604 CAAGGGAGGAGGCCGGGGACTGG - Intronic
1034786620 7:153932366-153932388 CACTTTGGGAGGCCGAGGAGTGG - Intronic
1035395776 7:158534008-158534030 CCCTGATGGAGCCCGGGGGGTGG - Intronic
1035395823 7:158534158-158534180 CCCTGACGGAGCCCGGGGTGTGG - Intronic
1035395838 7:158534208-158534230 CCCTGATGGAGCCCGGGGGGTGG - Intronic
1035395855 7:158534258-158534280 CCCTGACGGAGCCCGGGGCGTGG - Intronic
1035395870 7:158534308-158534330 CCCTGACGGAGCCCGGGGCGTGG - Intronic
1036468342 8:9024668-9024690 CACTTTAGGAGGCCGAGGGGGGG - Intronic
1037362010 8:18084076-18084098 CTCTGCTGGAGTCCGGGGAGTGG - Intronic
1037473771 8:19237149-19237171 CTCAGAGGCAGGCCGGGGAGTGG - Intergenic
1037939907 8:22943649-22943671 CACTTAGGGAGGCCGAGGCGGGG - Intronic
1038260901 8:25993020-25993042 CACTGAAGGAGGTGGGGGCAGGG - Intronic
1038448187 8:27618798-27618820 CACTTCAGGAGGCCGAGGTGGGG + Intergenic
1039009927 8:33082417-33082439 CACTGTGGGAGGCCGAGGGGTGG - Intergenic
1039051871 8:33502577-33502599 CACTTTAGGAGGCTGAGGAGGGG + Intronic
1039201659 8:35101334-35101356 CTCAGAAGGAGGACGGTGAGAGG - Intergenic
1039521457 8:38175962-38175984 CACGAAAGAAGCCCGGGGAGGGG - Intronic
1039526149 8:38218095-38218117 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1039612075 8:38928031-38928053 TACTGACAGAGGCTGGGGAGGGG + Intronic
1039716458 8:40114688-40114710 CACTTTAGGAGGCCTGGGACGGG - Intergenic
1039898388 8:41732656-41732678 CACTTTGGGAGGCCGAGGAGGGG - Intronic
1039984411 8:42435824-42435846 CACTGAAGGATGGCCGGGTGTGG + Intronic
1041719806 8:60965550-60965572 CCCTGATGGAGGGCAGGGAGGGG + Intergenic
1042554407 8:70022028-70022050 CACTGAGGGAGGGGAGGGAGAGG + Intergenic
1042572143 8:70177292-70177314 CACTGTAGGAGGCAGGAGAATGG - Intronic
1043959995 8:86406541-86406563 CACTGGAGGAGGCTGGTGAAGGG - Intronic
1046211500 8:111081789-111081811 CACTGAAGGAGGCACTGAAGAGG - Intergenic
1046948702 8:119999820-119999842 CAGTGAAGGAGGCCATAGAGGGG + Intronic
1047497028 8:125415845-125415867 CACTTCAGGAGGCCGAGGTGGGG - Intergenic
1047872294 8:129097486-129097508 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1047947404 8:129895248-129895270 CACTTTAGGAGGCCAGGGTGGGG - Intronic
1048381773 8:133871711-133871733 CTCTGAAGGAGGCCAGGGAGGGG + Intergenic
1048868992 8:138781790-138781812 CACTGACGGAGAGCTGGGAGTGG - Intronic
1049227328 8:141461813-141461835 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1049252450 8:141596575-141596597 CTCAGGAGGAGGCTGGGGAGGGG + Intergenic
1049469198 8:142767859-142767881 CACTTAATGAGGCCCAGGAGAGG + Intronic
1049479740 8:142816200-142816222 CACTGGAGGTGGCCCGGGAAGGG + Intergenic
1049548845 8:143247053-143247075 GACTGCTGGAGGGCGGGGAGAGG - Intergenic
1049778958 8:144418774-144418796 CGCTGTGGGAGGCCGGGGCGGGG + Intergenic
1049792485 8:144478334-144478356 CGACGGAGGAGGCCGGGGAGGGG + Intronic
1050444293 9:5702458-5702480 CAGAGCAGGAAGCCGGGGAGAGG + Intronic
1051050073 9:12922106-12922128 CACTTAAGGAAGCCAGGGACCGG - Intergenic
1051175227 9:14353525-14353547 GAATGAAGGGGGCTGGGGAGTGG + Intronic
1052946735 9:34174374-34174396 CACTTTAGGAGGCCGAGGTGGGG + Intergenic
1053487350 9:38469988-38470010 CACTCAAGGAGTTGGGGGAGTGG - Intergenic
1054335277 9:63801467-63801489 CACTTTGGGAGGCCGGGGTGGGG + Intergenic
1055861731 9:80758557-80758579 GAATGAATGAGGCAGGGGAGGGG + Intergenic
1055939964 9:81639991-81640013 CCCTGAAGCAGGGAGGGGAGGGG - Intronic
1056018286 9:82415456-82415478 CAGTGAGGGAGGTCTGGGAGAGG + Intergenic
1057492518 9:95532298-95532320 CACTGAAGGAGGCAAGGAAATGG + Intergenic
1057699688 9:97354816-97354838 CTCTGAAGGAGGAGGGGGACAGG - Intronic
1059309123 9:113376604-113376626 CACTTTGGGAGGCCGGGGGGCGG - Intronic
1059342407 9:113605218-113605240 CACTTTGGGAGGCCGAGGAGGGG + Intergenic
1059480739 9:114587543-114587565 CATTAAAAGAGGCCAGGGAGCGG + Intergenic
1060366718 9:123023426-123023448 CACTTTGGGAGGCCAGGGAGGGG - Intronic
1061002476 9:127910180-127910202 CTCTGGGGGAGGCTGGGGAGGGG + Intronic
1061180473 9:129022464-129022486 CTCAGAAGGAGGTGGGGGAGTGG + Intronic
1061508725 9:131047604-131047626 CACTCTGGGAGGCCGGGGTGGGG + Intronic
1061860838 9:133468072-133468094 CACTGAAGGACTTCGGGGGGCGG - Intronic
1061906683 9:133702720-133702742 CACAGAGGGAGGAGGGGGAGAGG + Intronic
1062461329 9:136663727-136663749 CTCTGCATGAGGCTGGGGAGAGG - Intronic
1062607512 9:137354815-137354837 CCCAGAAGGAGGCCGTGGTGAGG - Intronic
1062714894 9:138004299-138004321 CACTGCAGGAGGCTGAGGGGGGG + Intronic
1203365037 Un_KI270442v1:249147-249169 CACTGAAGAACGCGGGGTAGGGG - Intergenic
1185563558 X:1079198-1079220 CACTTTGGGAGGCCGGGGTGTGG - Intergenic
1185778865 X:2829013-2829035 CAGTGGAGGAGGCCTGGGCGCGG + Intronic
1186801195 X:13093611-13093633 GACTGATAGAGGCCGGTGAGGGG - Intergenic
1188359711 X:29237793-29237815 CTCTGAAGGAGGTAGGGCAGGGG + Intronic
1188932234 X:36125863-36125885 CACTGAGGGAGGAAGGTGAGAGG - Intronic
1189239225 X:39512762-39512784 CACTGATAGAGGGAGGGGAGAGG + Intergenic
1189352569 X:40287298-40287320 CACTTTGGGAGGCCGAGGAGGGG - Intergenic
1189874485 X:45421290-45421312 CACTGAAGGAGGCATTGAAGAGG - Intergenic
1190063569 X:47225751-47225773 CACTGCAGGAAGCATGGGAGTGG - Exonic
1190233211 X:48597978-48598000 CAGAGGAGGAGGCCGGGGAATGG + Exonic
1190525159 X:51321819-51321841 CACTTTAGGAGGCCAAGGAGAGG - Intergenic
1190740671 X:53286694-53286716 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1190898911 X:54650205-54650227 CACTGAAAGAGGCATGGAAGAGG + Intergenic
1192130209 X:68542828-68542850 CACTTTAGGAGGCTGAGGAGAGG - Intergenic
1192297131 X:69862687-69862709 GACTGTGGGAGGCCGAGGAGAGG - Intronic
1192364045 X:70455963-70455985 CACTGAAGGAGCATGGGGGGAGG - Intronic
1192793284 X:74405618-74405640 CACTGAAAGAGGCCCAGAAGAGG + Intergenic
1193248847 X:79264290-79264312 CACTGTGGGAGGCCGAGGTGAGG + Intergenic
1193588281 X:83355120-83355142 CACTGTGGGAGGCCATGGAGGGG - Intergenic
1194426852 X:93749165-93749187 CACTTTGGGAGGCCGGGGGGGGG + Intergenic
1194739124 X:97551116-97551138 CCATTAAGGAGGCAGGGGAGAGG + Intronic
1195225183 X:102785152-102785174 CACTGAAGGAGGCACTGAAGAGG - Intergenic
1195704578 X:107729654-107729676 GACAGAGGGAGGCAGGGGAGTGG + Intronic
1195707203 X:107746176-107746198 GACTGCAGGTGGCCTGGGAGAGG + Intronic
1195783172 X:108486227-108486249 CACTGAAGGAGGCACTGGAGAGG - Intronic
1195885440 X:109632739-109632761 CATTGGAGGAGGCCGTGCAGTGG - Intronic
1196466064 X:115972743-115972765 CACTGAAAGAGGCCCTGAAGAGG + Intergenic
1200209080 X:154337905-154337927 CACTGTGGGAGGCCGAGGCGGGG + Intergenic
1200221795 X:154394224-154394246 CACTGTGGGAGGCCGAGGCGGGG - Intronic
1200359530 X:155589200-155589222 CACTTTGGGAGGCCGAGGAGGGG + Intronic
1201073691 Y:10171250-10171272 CACTGAAGAACGCGGGGGCGGGG + Intergenic
1201291159 Y:12421491-12421513 CAGTGGAGGAGGCCTGGGCGCGG - Intergenic