ID: 1153936357

View in Genome Browser
Species Human (GRCh38)
Location 18:9928124-9928146
Sequence ATTCATATTGGGCAAATGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 189}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153936354_1153936357 -4 Left 1153936354 18:9928105-9928127 CCTAAATGTTAAACTAAGCATTC 0: 1
1: 0
2: 0
3: 16
4: 309
Right 1153936357 18:9928124-9928146 ATTCATATTGGGCAAATGATAGG 0: 1
1: 0
2: 0
3: 8
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153936357 Original CRISPR ATTCATATTGGGCAAATGAT AGG Intronic
904579716 1:31533365-31533387 AATCAAATTGTTCAAATGATAGG - Intergenic
906835271 1:49076673-49076695 ACACACATTGAGCAAATGATGGG + Intronic
908655171 1:66380931-66380953 AGTCATATTGGGCAAAAACTCGG - Intergenic
909492158 1:76237800-76237822 ATTCATTTTTTGCACATGATAGG - Intronic
910117295 1:83746069-83746091 TTGCATATTAGGCTAATGATGGG + Intergenic
910350361 1:86289481-86289503 ATTCATAAAGGGAAAAGGATTGG + Intergenic
910473568 1:87581288-87581310 AATCATTTTGGGAAAATGTTTGG - Intergenic
911527808 1:99006163-99006185 GTTGAAATTTGGCAAATGATTGG + Intergenic
912079200 1:105913841-105913863 CTTCAGAGTGGGGAAATGATAGG + Intergenic
913303454 1:117398334-117398356 ATGCATATGGGGCTATTGATGGG + Intronic
913697201 1:121338621-121338643 TTTCATATTGAGTAAATGCTGGG - Intronic
914140357 1:144941429-144941451 TTTCATATTGAGTAAATGCTGGG + Intronic
915810847 1:158909037-158909059 ATTAATATTGTTAAAATGATCGG + Intergenic
916458835 1:164999700-164999722 ATGCATATTGTGCAACTGCTTGG + Intergenic
916774786 1:167950272-167950294 TTTCATTTTGGTCAAAGGATTGG - Intronic
918322237 1:183375275-183375297 ATAAATATTTGTCAAATGATTGG - Intronic
919078539 1:192841443-192841465 CCTCATGTTGGGCAAATGAATGG + Intergenic
919557883 1:199083554-199083576 ATTTATCCTGGTCAAATGATGGG + Intergenic
919619944 1:199853044-199853066 TTTCATTTTGGGCAAATACTTGG + Intergenic
920484535 1:206356951-206356973 TTTCATATTGAGTAAATGCTGGG - Intronic
920614393 1:207475508-207475530 ATACATTTTTGGCAAATGTTTGG + Intronic
1063164164 10:3444752-3444774 ATTCAAATTGGGGGAATGAAGGG + Intergenic
1064796577 10:19018790-19018812 ATACATATTGAGTAAATGAGAGG + Intergenic
1068026486 10:51651539-51651561 CCTCATATTTGGCACATGATTGG + Intronic
1068778404 10:60892591-60892613 ACTCATTTTTGTCAAATGATTGG - Intronic
1069208483 10:65724056-65724078 AGGCATCTTTGGCAAATGATGGG + Intergenic
1069218402 10:65852002-65852024 AAAGATATTGGTCAAATGATTGG + Intergenic
1069361803 10:67651480-67651502 ATTCATACTGGACAAATTAATGG - Intronic
1070214777 10:74365698-74365720 ATTCATTTTGGGCAAATACCTGG + Intronic
1071935032 10:90520097-90520119 ATTCATGTTGTGCAAATGTCAGG + Intergenic
1074494793 10:113970376-113970398 ATTTATATTGGTGAAATGAGTGG - Intergenic
1075984274 10:126770167-126770189 GTTTTTATTGGGGAAATGATGGG - Intergenic
1078830623 11:14973484-14973506 ATTCAGAGTGGGCACATGTTGGG - Intronic
1079743723 11:24098695-24098717 ATACATAGTGATCAAATGATTGG + Intergenic
1082729162 11:56774037-56774059 ATTCATTTTGGGCAAATAGGTGG + Intergenic
1083761822 11:64822896-64822918 ATTCAAATGGGGTAAATGAAGGG - Intergenic
1085001838 11:73044676-73044698 ATTAAAATTAGGCAAATGCTGGG + Intronic
1086587768 11:88475564-88475586 ATTAATATTTGGAAAAGGATAGG + Intergenic
1087246112 11:95839376-95839398 ATTCATATTTCGCTAATAATAGG - Intronic
1088628036 11:111746754-111746776 ATTAAAATTTGGCAAATCATAGG - Intronic
1089583177 11:119494309-119494331 CTTGATCTTGGGCAAAGGATTGG + Intergenic
1092397329 12:8139201-8139223 ATCCATGTTGTGCAAATGACAGG + Intronic
1093736012 12:22621591-22621613 TTTTAAAATGGGCAAATGATCGG - Intergenic
1095153598 12:38825088-38825110 ATTCACACTGGGGAAATAATAGG - Intronic
1095369508 12:41450285-41450307 ACTGATATTGGGCATATGAGGGG - Intronic
1095482627 12:42651736-42651758 ACTCAGGGTGGGCAAATGATGGG + Intergenic
1101030293 12:100651624-100651646 ATTCATTTGTTGCAAATGATAGG + Intergenic
1101067897 12:101041836-101041858 ATTTATGTTGGGCAAATAAAGGG + Intronic
1107643539 13:42470254-42470276 ATCCATCTTGTGCAAATGACAGG - Intergenic
1107854959 13:44605834-44605856 ATGCATATTGGGGAAATGTCTGG - Intergenic
1107927880 13:45281007-45281029 ATTCATAAATGGAAAATGATTGG - Intronic
1109247210 13:59969806-59969828 ATTCCTAATGGGCAAATAAATGG - Intronic
1109479182 13:62926567-62926589 ACTCATATTTGGCATATTATAGG + Intergenic
1109996694 13:70136521-70136543 ATTTAGCTTGGGCAAATGAGTGG - Intergenic
1114897616 14:27010823-27010845 ATTCATTTGGGGCATGTGATAGG + Intergenic
1115635655 14:35288126-35288148 ATGCATATTCAACAAATGATTGG + Intronic
1115676950 14:35686761-35686783 ATGCATGTTTGGCAAATAATTGG - Intronic
1117842463 14:59873978-59874000 ATCCATGTTGTGCAAATGACAGG + Intergenic
1119935397 14:78587673-78587695 ATTCATTTTGGAAAGATGATTGG - Intronic
1119965004 14:78904814-78904836 ATTCATATTCAGTAACTGATTGG - Intronic
1123665309 15:22604266-22604288 ATTGATACTGTGCAAATGCTGGG - Intergenic
1123752449 15:23368381-23368403 ATTGATACTGTGCAAATGCTGGG + Intergenic
1124319144 15:28698688-28698710 ATTGATACTGTGCAAATGCTGGG - Intergenic
1124483377 15:30096751-30096773 ATTGATACTGTGCAAATGCTGGG + Intergenic
1124489830 15:30148813-30148835 ATTGATACTGTGCAAATGCTGGG + Intergenic
1124520200 15:30400475-30400497 ATTGATACTGTGCAAATGCTGGG - Intergenic
1124538456 15:30565749-30565771 ATTGATACTGTGCAAATGCTGGG + Intergenic
1124544919 15:30617812-30617834 ATTGATACTGTGCAAATGCTGGG + Intergenic
1124753700 15:32389513-32389535 ATTGATACTGTGCAAATGCTGGG - Intergenic
1124760196 15:32441836-32441858 ATTGATACTGTGCAAATGCTGGG - Intergenic
1124778440 15:32607222-32607244 ATTGATACTGTGCAAATGCTGGG + Exonic
1124876856 15:33602982-33603004 TTTCATATTGCTCAAAAGATGGG - Intronic
1124958819 15:34378986-34379008 ATTGATATTGTGCAAATACTGGG - Intergenic
1126834785 15:52649959-52649981 ATTCATATGCTGCAAAAGATGGG - Intronic
1130790004 15:87144047-87144069 ATACAGATTTGGGAAATGATTGG - Intergenic
1137888252 16:52129625-52129647 ATTAATATTAGTAAAATGATAGG - Intergenic
1140972564 16:80027698-80027720 TTTCATATGGGCAAAATGATAGG - Intergenic
1148674497 17:49437556-49437578 ATTTATTTGGGGCAAATGAAGGG + Intronic
1153209645 18:2746846-2746868 ATTAATATTGGGCACATCAAAGG - Intronic
1153936357 18:9928124-9928146 ATTCATATTGGGCAAATGATAGG + Intronic
1154939362 18:21095538-21095560 ATCTATGTTGTGCAAATGATAGG - Intronic
1155641375 18:28019692-28019714 ATTCATATTGGTCATAGGTTAGG - Intronic
1155931337 18:31712118-31712140 ATTGATTTTTGGAAAATGATAGG - Intergenic
1157049864 18:44150581-44150603 ATTCATATTAGGTTTATGATAGG + Intergenic
1157797770 18:50591061-50591083 ATTCATATTGGCACAATAATTGG + Intronic
1157912366 18:51629001-51629023 ATACATACTGGGCAAATGGCTGG + Intergenic
1158704274 18:59777497-59777519 ATTCATATTGTACAGTTGATTGG + Intergenic
1159286687 18:66362852-66362874 AGTCATTTTTAGCAAATGATTGG + Intergenic
1164113935 19:22198181-22198203 ATTCATATTGGGGAAAACCTGGG - Intergenic
1164164012 19:22651698-22651720 ATTCCTATTGGGGAAAAGCTGGG + Intronic
1164175630 19:22771647-22771669 ATTCCTATTGGGGAAAAGCTGGG - Intronic
1164546151 19:29164759-29164781 GTTCATTTTGGCAAAATGATGGG - Intergenic
1166480664 19:43170256-43170278 ATTCCTCTTGGGAAATTGATGGG + Intronic
1166753803 19:45178488-45178510 ATTCCTATTGGCCAAATTACTGG + Intronic
926537024 2:14125641-14125663 ATCAGTGTTGGGCAAATGATTGG + Intergenic
927580392 2:24239021-24239043 ATTGAGATTGTGCAAATGCTGGG - Intronic
929471819 2:42201661-42201683 ATCCATGTTGTGCAAATGACAGG - Intronic
935693668 2:105751963-105751985 ATATATATTGGGCAAAATATAGG - Intronic
939817069 2:146909466-146909488 ATTCATAATTGGCTAGTGATAGG + Intergenic
940492890 2:154387728-154387750 ATTCATGTTGTCAAAATGATGGG + Intronic
941205349 2:162565435-162565457 ATAAATATTGGGCAAATTAGGGG + Intronic
942537402 2:176979405-176979427 ATTAATATTGGGCTTGTGATTGG - Intergenic
942880208 2:180851434-180851456 ATTCATATTTATCAAAAGATGGG + Intergenic
943374939 2:187064952-187064974 ATTCATTTTGGGAAAAGAATTGG + Intergenic
943572472 2:189589994-189590016 ATCCATATTGCTCAAATGACAGG + Intergenic
945541691 2:211095680-211095702 ATACAAATTGGGCATATTATTGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945939628 2:215935107-215935129 ATCCATGTTGTGCAAATGACAGG + Intergenic
946070200 2:217028389-217028411 ATTCAGTGTGGGCCAATGATTGG - Intergenic
948217128 2:236240090-236240112 ATACAGAATGTGCAAATGATGGG + Intronic
948573423 2:238932887-238932909 TTTCATATTGGGTAAATCGTGGG - Intergenic
1171024876 20:21620929-21620951 ATTAAAAATGGGCAAAAGATCGG + Intergenic
1174749455 20:53097292-53097314 ATTTTTATTGGGAAAATCATGGG - Intronic
1177029942 21:15969839-15969861 ATTCTTTTTGGGGGAATGATGGG + Intergenic
1178433460 21:32536548-32536570 ATTCATATTGGATAAAGGACTGG - Intergenic
1178695542 21:34790294-34790316 ATTCAAATTAGGCAAATCTTTGG - Exonic
1183766829 22:39885168-39885190 GTTAATAATGGGCAAAGGATTGG + Intronic
949094395 3:68742-68764 AATTATATTTGGCAAATGAGAGG - Intergenic
949366163 3:3283341-3283363 ATCCATTTTTGGCAAATGACAGG + Intergenic
951513624 3:23532885-23532907 TTTCCTTTTTGGCAAATGATAGG - Intronic
951715735 3:25643858-25643880 ATTCATATAGTGTAAATGACAGG - Intronic
952249292 3:31634407-31634429 ATTTATTTGGGGAAAATGATGGG - Intronic
955903275 3:63779913-63779935 ATTCCAATTGGGAAAATGATTGG - Intergenic
956165070 3:66392216-66392238 ATTCATAATGGCCAAAATATGGG - Intronic
956237396 3:67089363-67089385 ATTAAAAATGGGCAAAAGATCGG + Intergenic
956453467 3:69396896-69396918 ATTCATAATAGCCAAATGGTGGG + Intronic
956471685 3:69573676-69573698 ACTTATATTGGGTAAATTATTGG - Intergenic
959555187 3:107708968-107708990 ATTGAAATTGGTCAAAGGATAGG + Intronic
961158338 3:124700186-124700208 AAGCATCTTGGGCAAATGTTAGG + Intronic
961520211 3:127463002-127463024 TTTCATATTTGGAAAATGAAAGG - Intergenic
961549396 3:127660456-127660478 ATTCATCTTGGGCAAGGGAGAGG - Exonic
967056108 3:185829695-185829717 TTTCATATTATGCAAATGCTAGG + Intergenic
970337457 4:15063982-15064004 ATTCATATTGGAGAGATGAAAGG - Intronic
976111147 4:81675087-81675109 GTTCATATGGAGCAAATGAAAGG - Intronic
976565241 4:86545606-86545628 TTTCATGGTGGGCAAATGGTGGG + Intronic
977440640 4:97062759-97062781 ATTCATATTGTACAAAGGGTGGG + Intergenic
980757511 4:137184958-137184980 ATCCATGTTGTGAAAATGATGGG + Intergenic
981491178 4:145341074-145341096 ATTCGTTTTTGGCAAATGAGAGG - Intergenic
981745874 4:148051905-148051927 CTTTAAATTGGGCAAATGAATGG + Intronic
983398114 4:167228831-167228853 ATTCATATTGTTTAAATCATGGG - Intronic
987015206 5:13810916-13810938 ATTCATGTTGTTCAAATGACAGG - Intronic
991055970 5:62321186-62321208 ATTCATAATGGCCAAAAAATGGG - Intronic
992331969 5:75726384-75726406 ATCCATTTTGTTCAAATGATAGG + Intergenic
993346286 5:86787390-86787412 ATTGATATTAGGAAAATGGTAGG + Intergenic
993929909 5:93925429-93925451 ACTAATACTGGGCAAATAATGGG - Intronic
995160817 5:108978903-108978925 ATTCAGATTGGAGAAATTATTGG + Intronic
996260343 5:121459084-121459106 ATTCTGTTTGGGGAAATGATGGG + Intergenic
996281911 5:121740179-121740201 ATCCATATTGGGGAAAGGAGTGG - Intergenic
996377756 5:122831653-122831675 ATTAATATTGAGCAAAAGATAGG + Intergenic
998297851 5:140988709-140988731 ATTACTATGGGGCAAATGAGAGG - Intronic
999593165 5:153171458-153171480 ATTCAGAAAGTGCAAATGATAGG + Intergenic
1004012652 6:11704015-11704037 ATTCCTATTTGACAAATGAGGGG - Intergenic
1007022572 6:38536658-38536680 ATCCATGTTGTGCAAATGATAGG - Intronic
1008765173 6:54904038-54904060 AATTATATTGGCCAAATGAGAGG - Intronic
1011566667 6:88680981-88681003 TTTCTTATTTGTCAAATGATGGG - Intronic
1011702166 6:89965927-89965949 ATTCCTATTTTGCAAATGAAAGG - Intronic
1013060878 6:106632776-106632798 ATTAAAAATGGGCAAAAGATTGG - Intronic
1013231139 6:108163479-108163501 ATAAATGTTGGGCAAATGAAGGG - Intronic
1016537404 6:145124351-145124373 GATCAAATTGGTCAAATGATAGG + Intergenic
1017579398 6:155846136-155846158 TTTAAAAATGGGCAAATGATTGG + Intergenic
1018233409 6:161698781-161698803 ATTCATTTTGTGCAAATCAGTGG - Intronic
1021001214 7:15332521-15332543 AGCCATGTTGGGCAAGTGATGGG - Intronic
1021018007 7:15559685-15559707 ATTCATATTATGGAAATGCTTGG + Intronic
1024289335 7:47790253-47790275 ATGAAAATTGGGCAAATGATAGG - Intronic
1025822599 7:64983244-64983266 ATTCCTATTGGGGAAAAGCTAGG - Intronic
1025866467 7:65386457-65386479 ATTCCTATTGGGGAAAAGCTGGG + Intronic
1027973312 7:85115387-85115409 ATTCATATTGAGCAAAACATTGG - Intronic
1030090379 7:105852801-105852823 ATTCACAATGCCCAAATGATTGG + Intronic
1031207890 7:118784835-118784857 ATTCACAATGGTCAAATGATGGG - Intergenic
1031800590 7:126239343-126239365 TTTCATATTGTACAAAAGATAGG - Intergenic
1034568662 7:151936691-151936713 ATTCTAAGTGGGGAAATGATAGG - Intergenic
1035439813 7:158887379-158887401 ATTCAGAATGAGCAAATAATTGG + Intronic
1041827484 8:62112459-62112481 ATTTAAAATGGGCAAAGGATTGG - Intergenic
1042463482 8:69098693-69098715 ATTCAAATTAGCCTAATGATTGG + Intergenic
1043088464 8:75867523-75867545 ATTCATAATAGCCAAAAGATAGG - Intergenic
1046224180 8:111255472-111255494 ATTCGTAGTGAGCAAATTATTGG + Intergenic
1046656172 8:116897953-116897975 ATTAAAAATGGGCAAAAGATTGG + Intergenic
1047040200 8:120985442-120985464 AATCATAATGGGCAAAGGATGGG - Intergenic
1048403421 8:134094100-134094122 ATTCAAATTGAACAAATCATGGG - Intergenic
1051464495 9:17361845-17361867 TTTCTTACTGGACAAATGATAGG - Intronic
1051830283 9:21268258-21268280 ATTCATAAGGGGAAAGTGATGGG + Intergenic
1053231312 9:36412418-36412440 ATTCATGTTGTGCAAGTAATTGG - Intronic
1054842384 9:69757364-69757386 AAATATATTGGACAAATGATTGG - Intronic
1054863863 9:69979994-69980016 ATTTAGATTTGCCAAATGATGGG - Intergenic
1058406462 9:104681054-104681076 ATCCATGTTGTGCAAATGACAGG - Intergenic
1060214373 9:121729865-121729887 ATTCCTATAGGGCAAATAATTGG + Intronic
1060810458 9:126609132-126609154 ATACATATTTGGTAAATAATTGG - Intergenic
1189953909 X:46259239-46259261 ATTTATATAGGGCCAAAGATTGG - Intergenic
1191591914 X:62895271-62895293 ATTTAAATTGGGCAAAGGACAGG - Intergenic
1192536300 X:71930820-71930842 ATTCATAATAGCCAAAGGATAGG - Intergenic
1193335854 X:80288025-80288047 ATCCATGTTGAGCAAATGACAGG - Intergenic
1194256689 X:91644054-91644076 ATTAAAAATGGGCAAAAGATTGG - Intergenic
1195216440 X:102708823-102708845 TTTAAAATTGGGTAAATGATGGG + Intergenic
1195278535 X:103308129-103308151 ATTCTTATAGGCCAAATAATAGG + Intergenic
1196682144 X:118480228-118480250 ATTCATAATAGCCAAAAGATGGG - Intergenic
1200575406 Y:4883316-4883338 ATTAAAAATGGGCAAAAGATTGG - Intergenic
1202345408 Y:23918422-23918444 GTGCATATTGGTCAAATTATTGG - Intergenic
1202525362 Y:25751667-25751689 GTGCATATTGGTCAAATTATTGG + Intergenic