ID: 1153936965

View in Genome Browser
Species Human (GRCh38)
Location 18:9935994-9936016
Sequence GATTTGCCTTAAACCGTATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 40}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153936965 Original CRISPR GATTTGCCTTAAACCGTATC TGG (reversed) Intronic
903576236 1:24341372-24341394 GATTTGTCTGAAGCCGTATATGG + Intronic
906478051 1:46183186-46183208 GATTTGCCTTTAACCCTCTCAGG - Intronic
907948289 1:59155791-59155813 GATGTGCCTTAAACTCTGTCTGG + Intergenic
912630944 1:111246408-111246430 AATTTGCCTTTAAACGGATCCGG + Intergenic
1067327180 10:45280651-45280673 GAATTACCTTAAATCCTATCAGG + Intergenic
1075609904 10:123844538-123844560 GATTGACCTTAGACAGTATCAGG - Intronic
1084222842 11:67695159-67695181 GATCCGCCTTAAGCCGTATGAGG + Intergenic
1087640412 11:100749689-100749711 GATCTGCCTTAAGCCATATGAGG + Intronic
1091369499 11:135046824-135046846 GAGATGCCTTTAACCGTCTCAGG + Intergenic
1092436537 12:8451670-8451692 GTTTTCCCTTAACCCTTATCAGG - Intergenic
1093989304 12:25572054-25572076 GATTTGCACTGAAACGTATCTGG - Intronic
1098571197 12:71989175-71989197 GAATTGCCTAAAATCTTATCTGG + Intronic
1107919891 13:45194776-45194798 AATTTGCATTTAACTGTATCAGG + Intronic
1115474962 14:33804721-33804743 GACCTGCCTTAAAACGTAACAGG - Intergenic
1116369564 14:44112001-44112023 GATTTTCTTTAAACTATATCTGG - Intergenic
1127987177 15:64082619-64082641 GATCTGCCTTAAAGCATATCTGG + Intronic
1129785272 15:78305974-78305996 TATTTCCCTTAAACTGTAACTGG - Intergenic
1130709830 15:86268981-86269003 GTTTTGACTTAAACATTATCAGG - Intronic
1132942814 16:2516584-2516606 GATTGGTCTTAAACCGAATGAGG + Intronic
1138992930 16:62413520-62413542 GATTTTCCTTATTCAGTATCAGG + Intergenic
1141291982 16:82726726-82726748 TAAGTGCCTTAAACAGTATCTGG + Intronic
1141519146 16:84566158-84566180 AATTTGCCTTAAAACTTACCTGG - Exonic
1151115590 17:71731595-71731617 GATTTTCCTTAGAGCGTTTCAGG + Intergenic
1152529932 17:80912013-80912035 GATTTTCCCTAATCCGTAGCAGG - Intronic
1153936965 18:9935994-9936016 GATTTGCCTTAAACCGTATCTGG - Intronic
1160277216 18:77448223-77448245 GAAGTGCCTTAAACCGTGTGTGG - Intergenic
1160531747 18:79569371-79569393 GATTTGCCATAAACCTCACCTGG + Intergenic
930988980 2:57627751-57627773 GATATGCCTTAACCCTTAACTGG - Intergenic
938149243 2:128867757-128867779 GATTTGCCATAAAACTTAACCGG - Intergenic
938578264 2:132623341-132623363 GATCTTCCTTCAACGGTATCAGG - Intronic
1176031397 20:63014713-63014735 GATTTGCCCTCAACAGAATCTGG - Intergenic
972997325 4:44896890-44896912 GATTTGACTTAAAATGTATAAGG + Intergenic
979545453 4:121934806-121934828 CATTTGCCTTAGTCCCTATCTGG - Intronic
982116088 4:152099536-152099558 GATGTGCATTAAACCATCTCTGG + Intergenic
991315708 5:65303092-65303114 GATTTTAATTAAACCATATCAGG + Intronic
997041601 5:130262813-130262835 CTTTTGCCTTAAAATGTATCTGG + Intergenic
1000870136 5:166566006-166566028 GATTTTTCTTAAACCAAATCTGG - Intergenic
1017223307 6:151991476-151991498 AATTTTCCTTCAACCGTATTTGG - Intronic
1033179928 7:139166461-139166483 GATTTGCTTTAAAACATTTCAGG - Intronic
1046322074 8:112592791-112592813 GATATGCCTGATACCGTATTAGG + Intronic
1050828119 9:9975253-9975275 GATTTGTCTTAAAGCTTATCTGG - Intronic
1054907395 9:70422846-70422868 GATTTGCCTTAGACAGGAGCAGG - Intergenic
1188694192 X:33169062-33169084 GATTTACCTTCAACAGTATTGGG + Intronic
1194427921 X:93762869-93762891 GATTGGCTTTAAAGCCTATCTGG + Intergenic