ID: 1153940029

View in Genome Browser
Species Human (GRCh38)
Location 18:9969359-9969381
Sequence CCCCTCCTCCCAGCGTGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153940029_1153940036 13 Left 1153940029 18:9969359-9969381 CCCTTCCACGCTGGGAGGAGGGG No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153940029 Original CRISPR CCCCTCCTCCCAGCGTGGAA GGG (reversed) Intergenic
No off target data available for this crispr