ID: 1153940031

View in Genome Browser
Species Human (GRCh38)
Location 18:9969360-9969382
Sequence GCCCCTCCTCCCAGCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153940031_1153940036 12 Left 1153940031 18:9969360-9969382 CCTTCCACGCTGGGAGGAGGGGC No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153940031 Original CRISPR GCCCCTCCTCCCAGCGTGGA AGG (reversed) Intergenic
No off target data available for this crispr