ID: 1153940033

View in Genome Browser
Species Human (GRCh38)
Location 18:9969364-9969386
Sequence ACCAGCCCCTCCTCCCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153940033_1153940036 8 Left 1153940033 18:9969364-9969386 CCACGCTGGGAGGAGGGGCTGGT No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153940033 Original CRISPR ACCAGCCCCTCCTCCCAGCG TGG (reversed) Intergenic
No off target data available for this crispr