ID: 1153940036

View in Genome Browser
Species Human (GRCh38)
Location 18:9969395-9969417
Sequence TCGTTTTCACGCCTGTTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153940029_1153940036 13 Left 1153940029 18:9969359-9969381 CCCTTCCACGCTGGGAGGAGGGG No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data
1153940033_1153940036 8 Left 1153940033 18:9969364-9969386 CCACGCTGGGAGGAGGGGCTGGT No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data
1153940031_1153940036 12 Left 1153940031 18:9969360-9969382 CCTTCCACGCTGGGAGGAGGGGC No data
Right 1153940036 18:9969395-9969417 TCGTTTTCACGCCTGTTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153940036 Original CRISPR TCGTTTTCACGCCTGTTCTG AGG Intergenic
No off target data available for this crispr