ID: 1153943380

View in Genome Browser
Species Human (GRCh38)
Location 18:9996051-9996073
Sequence GTGCATGCACGTGTGTGTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153943376_1153943380 18 Left 1153943376 18:9996010-9996032 CCTCATGCATGCATGCATGCACA No data
Right 1153943380 18:9996051-9996073 GTGCATGCACGTGTGTGTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153943380 Original CRISPR GTGCATGCACGTGTGTGTTG GGG Intergenic
No off target data available for this crispr