ID: 1153944562

View in Genome Browser
Species Human (GRCh38)
Location 18:10007795-10007817
Sequence AATAAAAGGCAGCAGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153944562_1153944569 19 Left 1153944562 18:10007795-10007817 CCCTCCAGCTGCTGCCTTTTATT No data
Right 1153944569 18:10007837-10007859 TATTTGCATTTCTCATTACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153944562 Original CRISPR AATAAAAGGCAGCAGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr