ID: 1153945969

View in Genome Browser
Species Human (GRCh38)
Location 18:10017643-10017665
Sequence GCTTCTGTTCTGTGGGTACA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153945959_1153945969 8 Left 1153945959 18:10017612-10017634 CCACGGCCCACTGACGGTCGCTC No data
Right 1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG No data
1153945962_1153945969 2 Left 1153945962 18:10017618-10017640 CCCACTGACGGTCGCTCCGGGCC No data
Right 1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG No data
1153945963_1153945969 1 Left 1153945963 18:10017619-10017641 CCACTGACGGTCGCTCCGGGCCA No data
Right 1153945969 18:10017643-10017665 GCTTCTGTTCTGTGGGTACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153945969 Original CRISPR GCTTCTGTTCTGTGGGTACA CGG Intergenic
No off target data available for this crispr