ID: 1153947322

View in Genome Browser
Species Human (GRCh38)
Location 18:10029381-10029403
Sequence GGAAAAAGAAGACACTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153947317_1153947322 -2 Left 1153947317 18:10029360-10029382 CCTTGGGTTTGGGTCACAGAGGG No data
Right 1153947322 18:10029381-10029403 GGAAAAAGAAGACACTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153947322 Original CRISPR GGAAAAAGAAGACACTGGGG AGG Intergenic
No off target data available for this crispr