ID: 1153948055

View in Genome Browser
Species Human (GRCh38)
Location 18:10034070-10034092
Sequence ATCTCTTGGCACCAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153948055_1153948060 -8 Left 1153948055 18:10034070-10034092 CCAGGCTGCTGGTGCCAAGAGAT No data
Right 1153948060 18:10034085-10034107 CAAGAGATGGGTGGATCGACAGG No data
1153948055_1153948061 6 Left 1153948055 18:10034070-10034092 CCAGGCTGCTGGTGCCAAGAGAT No data
Right 1153948061 18:10034099-10034121 ATCGACAGGTCTTGTTAGCAAGG No data
1153948055_1153948062 13 Left 1153948055 18:10034070-10034092 CCAGGCTGCTGGTGCCAAGAGAT No data
Right 1153948062 18:10034106-10034128 GGTCTTGTTAGCAAGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153948055 Original CRISPR ATCTCTTGGCACCAGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr