ID: 1153948808

View in Genome Browser
Species Human (GRCh38)
Location 18:10039797-10039819
Sequence CCCCATCAGCAACTGTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153948797_1153948808 19 Left 1153948797 18:10039755-10039777 CCCCCAGGTTTCCAGTGGGGCTG No data
Right 1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG No data
1153948804_1153948808 8 Left 1153948804 18:10039766-10039788 CCAGTGGGGCTGGTGGTTGAGGA No data
Right 1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG No data
1153948798_1153948808 18 Left 1153948798 18:10039756-10039778 CCCCAGGTTTCCAGTGGGGCTGG No data
Right 1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG No data
1153948801_1153948808 16 Left 1153948801 18:10039758-10039780 CCAGGTTTCCAGTGGGGCTGGTG No data
Right 1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG No data
1153948800_1153948808 17 Left 1153948800 18:10039757-10039779 CCCAGGTTTCCAGTGGGGCTGGT No data
Right 1153948808 18:10039797-10039819 CCCCATCAGCAACTGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153948808 Original CRISPR CCCCATCAGCAACTGTGCCC AGG Intergenic
No off target data available for this crispr