ID: 1153949883

View in Genome Browser
Species Human (GRCh38)
Location 18:10049509-10049531
Sequence ATGGAAAAGCCCATTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153949872_1153949883 17 Left 1153949872 18:10049469-10049491 CCACCAACAAGCCCATGCTTGTC No data
Right 1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG No data
1153949874_1153949883 6 Left 1153949874 18:10049480-10049502 CCCATGCTTGTCTTTGTCTGTAG No data
Right 1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG No data
1153949875_1153949883 5 Left 1153949875 18:10049481-10049503 CCATGCTTGTCTTTGTCTGTAGA No data
Right 1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG No data
1153949873_1153949883 14 Left 1153949873 18:10049472-10049494 CCAACAAGCCCATGCTTGTCTTT No data
Right 1153949883 18:10049509-10049531 ATGGAAAAGCCCATTGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153949883 Original CRISPR ATGGAAAAGCCCATTGGGGA GGG Intergenic
No off target data available for this crispr