ID: 1153950038

View in Genome Browser
Species Human (GRCh38)
Location 18:10050778-10050800
Sequence CAGTGGTCCTAGAGATAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153950033_1153950038 -2 Left 1153950033 18:10050757-10050779 CCTTTAGCATCCCTCCACTTACA No data
Right 1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG No data
1153950032_1153950038 8 Left 1153950032 18:10050747-10050769 CCAGTCAATGCCTTTAGCATCCC No data
Right 1153950038 18:10050778-10050800 CAGTGGTCCTAGAGATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153950038 Original CRISPR CAGTGGTCCTAGAGATAACA TGG Intergenic
No off target data available for this crispr