ID: 1153950646

View in Genome Browser
Species Human (GRCh38)
Location 18:10054955-10054977
Sequence AATGAAGCAAGGCTTCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153950646_1153950651 13 Left 1153950646 18:10054955-10054977 CCACACTGAAGCCTTGCTTCATT No data
Right 1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG No data
1153950646_1153950649 -9 Left 1153950646 18:10054955-10054977 CCACACTGAAGCCTTGCTTCATT No data
Right 1153950649 18:10054969-10054991 TGCTTCATTTGACTGCTCCTGGG No data
1153950646_1153950652 14 Left 1153950646 18:10054955-10054977 CCACACTGAAGCCTTGCTTCATT No data
Right 1153950652 18:10054992-10055014 ACCCCATCACTGTGCTGACTGGG No data
1153950646_1153950648 -10 Left 1153950646 18:10054955-10054977 CCACACTGAAGCCTTGCTTCATT No data
Right 1153950648 18:10054968-10054990 TTGCTTCATTTGACTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153950646 Original CRISPR AATGAAGCAAGGCTTCAGTG TGG (reversed) Intergenic
No off target data available for this crispr