ID: 1153950647

View in Genome Browser
Species Human (GRCh38)
Location 18:10054966-10054988
Sequence AGGAGCAGTCAAATGAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153950647_1153950652 3 Left 1153950647 18:10054966-10054988 CCTTGCTTCATTTGACTGCTCCT No data
Right 1153950652 18:10054992-10055014 ACCCCATCACTGTGCTGACTGGG No data
1153950647_1153950651 2 Left 1153950647 18:10054966-10054988 CCTTGCTTCATTTGACTGCTCCT No data
Right 1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG No data
1153950647_1153950656 25 Left 1153950647 18:10054966-10054988 CCTTGCTTCATTTGACTGCTCCT No data
Right 1153950656 18:10055014-10055036 GATCCTGAGCCTGAGCCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153950647 Original CRISPR AGGAGCAGTCAAATGAAGCA AGG (reversed) Intergenic
No off target data available for this crispr