ID: 1153950651

View in Genome Browser
Species Human (GRCh38)
Location 18:10054991-10055013
Sequence GACCCCATCACTGTGCTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153950646_1153950651 13 Left 1153950646 18:10054955-10054977 CCACACTGAAGCCTTGCTTCATT No data
Right 1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG No data
1153950647_1153950651 2 Left 1153950647 18:10054966-10054988 CCTTGCTTCATTTGACTGCTCCT No data
Right 1153950651 18:10054991-10055013 GACCCCATCACTGTGCTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153950651 Original CRISPR GACCCCATCACTGTGCTGAC TGG Intergenic
No off target data available for this crispr