ID: 1153956072

View in Genome Browser
Species Human (GRCh38)
Location 18:10097372-10097394
Sequence TGGGCCATTCTCCTGGGATA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153956067_1153956072 -1 Left 1153956067 18:10097350-10097372 CCTGAAGAAAGGATGGCAAATCT No data
Right 1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG No data
1153956064_1153956072 6 Left 1153956064 18:10097343-10097365 CCAAATCCCTGAAGAAAGGATGG No data
Right 1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG No data
1153956062_1153956072 29 Left 1153956062 18:10097320-10097342 CCTGGGAGGGAAGGAAAAACTCA No data
Right 1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG No data
1153956066_1153956072 0 Left 1153956066 18:10097349-10097371 CCCTGAAGAAAGGATGGCAAATC No data
Right 1153956072 18:10097372-10097394 TGGGCCATTCTCCTGGGATACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153956072 Original CRISPR TGGGCCATTCTCCTGGGATA CGG Intergenic
No off target data available for this crispr