ID: 1153956888

View in Genome Browser
Species Human (GRCh38)
Location 18:10104029-10104051
Sequence CTGCTGGCTGCATCCTAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153956888_1153956893 7 Left 1153956888 18:10104029-10104051 CCTGCTTAGGATGCAGCCAGCAG No data
Right 1153956893 18:10104059-10104081 GAACACAGAGATAGGAAAGCTGG No data
1153956888_1153956894 30 Left 1153956888 18:10104029-10104051 CCTGCTTAGGATGCAGCCAGCAG No data
Right 1153956894 18:10104082-10104104 CATTTCTTTTTTTCTTTTTTTGG No data
1153956888_1153956892 -1 Left 1153956888 18:10104029-10104051 CCTGCTTAGGATGCAGCCAGCAG No data
Right 1153956892 18:10104051-10104073 GGCGAGTGGAACACAGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153956888 Original CRISPR CTGCTGGCTGCATCCTAAGC AGG (reversed) Intergenic
No off target data available for this crispr