ID: 1153962876

View in Genome Browser
Species Human (GRCh38)
Location 18:10154298-10154320
Sequence AAGGAGAAGAAAAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153962874_1153962876 13 Left 1153962874 18:10154262-10154284 CCTGATTATAGAGGGGATACAAT No data
Right 1153962876 18:10154298-10154320 AAGGAGAAGAAAAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153962876 Original CRISPR AAGGAGAAGAAAAATGATGA AGG Intergenic
No off target data available for this crispr