ID: 1153964153

View in Genome Browser
Species Human (GRCh38)
Location 18:10165696-10165718
Sequence AGCACCGCTGAGGGCCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153964149_1153964153 -9 Left 1153964149 18:10165682-10165704 CCTGAAGTCAGCACAGCACCGCT No data
Right 1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG No data
1153964148_1153964153 -6 Left 1153964148 18:10165679-10165701 CCACCTGAAGTCAGCACAGCACC No data
Right 1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG No data
1153964146_1153964153 5 Left 1153964146 18:10165668-10165690 CCACTGAGAGCCCACCTGAAGTC No data
Right 1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG No data
1153964147_1153964153 -5 Left 1153964147 18:10165678-10165700 CCCACCTGAAGTCAGCACAGCAC No data
Right 1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG No data
1153964145_1153964153 9 Left 1153964145 18:10165664-10165686 CCTGCCACTGAGAGCCCACCTGA No data
Right 1153964153 18:10165696-10165718 AGCACCGCTGAGGGCCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153964153 Original CRISPR AGCACCGCTGAGGGCCCCGA GGG Intergenic
No off target data available for this crispr