ID: 1153964211

View in Genome Browser
Species Human (GRCh38)
Location 18:10165981-10166003
Sequence GCCCAAGGTGAATGCGCGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153964207_1153964211 6 Left 1153964207 18:10165952-10165974 CCGCTCAAGCTCTCTGCTGGGGA No data
Right 1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG No data
1153964205_1153964211 7 Left 1153964205 18:10165951-10165973 CCCGCTCAAGCTCTCTGCTGGGG No data
Right 1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG No data
1153964201_1153964211 12 Left 1153964201 18:10165946-10165968 CCCATCCCGCTCAAGCTCTCTGC No data
Right 1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG No data
1153964202_1153964211 11 Left 1153964202 18:10165947-10165969 CCATCCCGCTCAAGCTCTCTGCT No data
Right 1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG No data
1153964200_1153964211 22 Left 1153964200 18:10165936-10165958 CCGGCGAGGACCCATCCCGCTCA No data
Right 1153964211 18:10165981-10166003 GCCCAAGGTGAATGCGCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153964211 Original CRISPR GCCCAAGGTGAATGCGCGCA GGG Intergenic