ID: 1153965039

View in Genome Browser
Species Human (GRCh38)
Location 18:10172148-10172170
Sequence ATGTCTATCTAGAAAGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153965037_1153965039 2 Left 1153965037 18:10172123-10172145 CCATGGAGGAAGGGATGTAATAA No data
Right 1153965039 18:10172148-10172170 ATGTCTATCTAGAAAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153965039 Original CRISPR ATGTCTATCTAGAAAGGTGA AGG Intergenic
No off target data available for this crispr