ID: 1153967382

View in Genome Browser
Species Human (GRCh38)
Location 18:10194302-10194324
Sequence GGCCATGCCTGTTGTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153967376_1153967382 29 Left 1153967376 18:10194250-10194272 CCATGAATGTCAGCTACTATCAT No data
Right 1153967382 18:10194302-10194324 GGCCATGCCTGTTGTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153967382 Original CRISPR GGCCATGCCTGTTGTGGGGT GGG Intergenic
No off target data available for this crispr