ID: 1153967436

View in Genome Browser
Species Human (GRCh38)
Location 18:10194750-10194772
Sequence ATCTGAAAGCTTTAGAGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153967436_1153967440 6 Left 1153967436 18:10194750-10194772 CCTCCCCTCTAAAGCTTTCAGAT No data
Right 1153967440 18:10194779-10194801 CATGCTCAGCCTGCCCCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153967436 Original CRISPR ATCTGAAAGCTTTAGAGGGG AGG (reversed) Intergenic
No off target data available for this crispr