ID: 1153968613

View in Genome Browser
Species Human (GRCh38)
Location 18:10204310-10204332
Sequence CTAGGGTTCCTAAAGTCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153968609_1153968613 30 Left 1153968609 18:10204257-10204279 CCTGGTTATTTCTAACATTGCAT No data
Right 1153968613 18:10204310-10204332 CTAGGGTTCCTAAAGTCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153968613 Original CRISPR CTAGGGTTCCTAAAGTCTCT TGG Intergenic
No off target data available for this crispr