ID: 1153969318

View in Genome Browser
Species Human (GRCh38)
Location 18:10210835-10210857
Sequence CTGAGCCATCATTTTGTCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153969318_1153969320 20 Left 1153969318 18:10210835-10210857 CCAATGACAAAATGATGGCTCAG No data
Right 1153969320 18:10210878-10210900 CAATGAATTACAATTGCAAGAGG No data
1153969318_1153969321 21 Left 1153969318 18:10210835-10210857 CCAATGACAAAATGATGGCTCAG No data
Right 1153969321 18:10210879-10210901 AATGAATTACAATTGCAAGAGGG No data
1153969318_1153969322 22 Left 1153969318 18:10210835-10210857 CCAATGACAAAATGATGGCTCAG No data
Right 1153969322 18:10210880-10210902 ATGAATTACAATTGCAAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153969318 Original CRISPR CTGAGCCATCATTTTGTCAT TGG (reversed) Intergenic