ID: 1153969318 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:10210835-10210857 |
Sequence | CTGAGCCATCATTTTGTCAT TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1153969318_1153969320 | 20 | Left | 1153969318 | 18:10210835-10210857 | CCAATGACAAAATGATGGCTCAG | No data | ||
Right | 1153969320 | 18:10210878-10210900 | CAATGAATTACAATTGCAAGAGG | No data | ||||
1153969318_1153969321 | 21 | Left | 1153969318 | 18:10210835-10210857 | CCAATGACAAAATGATGGCTCAG | No data | ||
Right | 1153969321 | 18:10210879-10210901 | AATGAATTACAATTGCAAGAGGG | No data | ||||
1153969318_1153969322 | 22 | Left | 1153969318 | 18:10210835-10210857 | CCAATGACAAAATGATGGCTCAG | No data | ||
Right | 1153969322 | 18:10210880-10210902 | ATGAATTACAATTGCAAGAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1153969318 | Original CRISPR | CTGAGCCATCATTTTGTCAT TGG (reversed) | Intergenic | ||