ID: 1153969320

View in Genome Browser
Species Human (GRCh38)
Location 18:10210878-10210900
Sequence CAATGAATTACAATTGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153969318_1153969320 20 Left 1153969318 18:10210835-10210857 CCAATGACAAAATGATGGCTCAG No data
Right 1153969320 18:10210878-10210900 CAATGAATTACAATTGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153969320 Original CRISPR CAATGAATTACAATTGCAAG AGG Intergenic