ID: 1153973903

View in Genome Browser
Species Human (GRCh38)
Location 18:10249884-10249906
Sequence TCTTCCAGTGACTGGCTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153973898_1153973903 10 Left 1153973898 18:10249851-10249873 CCAAGACTCGCAGTTTGATCTTC No data
Right 1153973903 18:10249884-10249906 TCTTCCAGTGACTGGCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153973903 Original CRISPR TCTTCCAGTGACTGGCTCAG GGG Intergenic
No off target data available for this crispr