ID: 1153975626

View in Genome Browser
Species Human (GRCh38)
Location 18:10266346-10266368
Sequence ATTGTCGTGGTGACAAATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153975626_1153975632 24 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975632 18:10266393-10266415 CCAAGATTTTGAGACTGGCCAGG No data
1153975626_1153975629 -1 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975629 18:10266368-10266390 TCTCTTTCGACTTAAGCTTAGGG No data
1153975626_1153975628 -2 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975628 18:10266367-10266389 ATCTCTTTCGACTTAAGCTTAGG No data
1153975626_1153975630 19 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975630 18:10266388-10266410 GGGTTCCAAGATTTTGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153975626 Original CRISPR ATTGTCGTGGTGACAAATAG AGG (reversed) Intergenic
No off target data available for this crispr