ID: 1153975629

View in Genome Browser
Species Human (GRCh38)
Location 18:10266368-10266390
Sequence TCTCTTTCGACTTAAGCTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153975626_1153975629 -1 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975629 18:10266368-10266390 TCTCTTTCGACTTAAGCTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153975629 Original CRISPR TCTCTTTCGACTTAAGCTTA GGG Intergenic
No off target data available for this crispr