ID: 1153975632

View in Genome Browser
Species Human (GRCh38)
Location 18:10266393-10266415
Sequence CCAAGATTTTGAGACTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153975626_1153975632 24 Left 1153975626 18:10266346-10266368 CCTCTATTTGTCACCACGACAAT No data
Right 1153975632 18:10266393-10266415 CCAAGATTTTGAGACTGGCCAGG No data
1153975627_1153975632 11 Left 1153975627 18:10266359-10266381 CCACGACAATCTCTTTCGACTTA No data
Right 1153975632 18:10266393-10266415 CCAAGATTTTGAGACTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153975632 Original CRISPR CCAAGATTTTGAGACTGGCC AGG Intergenic
No off target data available for this crispr