ID: 1153976477

View in Genome Browser
Species Human (GRCh38)
Location 18:10272430-10272452
Sequence CCCAGAGCTCTGGCATTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153976473_1153976477 6 Left 1153976473 18:10272401-10272423 CCTGAGCTTGGTGCAACGCTATT No data
Right 1153976477 18:10272430-10272452 CCCAGAGCTCTGGCATTCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153976477 Original CRISPR CCCAGAGCTCTGGCATTCTT GGG Intergenic
No off target data available for this crispr