ID: 1153976732

View in Genome Browser
Species Human (GRCh38)
Location 18:10274815-10274837
Sequence CTTCACCTGAAAAATGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153976730_1153976732 25 Left 1153976730 18:10274767-10274789 CCCACTGATGATTGATTATTAAA No data
Right 1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG No data
1153976731_1153976732 24 Left 1153976731 18:10274768-10274790 CCACTGATGATTGATTATTAAAA No data
Right 1153976732 18:10274815-10274837 CTTCACCTGAAAAATGTGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153976732 Original CRISPR CTTCACCTGAAAAATGTGAA TGG Intergenic
No off target data available for this crispr