ID: 1153978905

View in Genome Browser
Species Human (GRCh38)
Location 18:10292754-10292776
Sequence TGATAACGGGACCACTGGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153978905_1153978909 11 Left 1153978905 18:10292754-10292776 CCTCTCCAGTGGTCCCGTTATCA No data
Right 1153978909 18:10292788-10292810 TAATTAGTCATGTCTTTTAGTGG No data
1153978905_1153978910 23 Left 1153978905 18:10292754-10292776 CCTCTCCAGTGGTCCCGTTATCA No data
Right 1153978910 18:10292800-10292822 TCTTTTAGTGGAGTCCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153978905 Original CRISPR TGATAACGGGACCACTGGAG AGG (reversed) Intergenic
No off target data available for this crispr