ID: 1153986627

View in Genome Browser
Species Human (GRCh38)
Location 18:10356779-10356801
Sequence GGTTACTATAGACAGTGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153986627_1153986634 18 Left 1153986627 18:10356779-10356801 CCAACCCACTGTCTATAGTAACC No data
Right 1153986634 18:10356820-10356842 CTGTTTACAGTAACCAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153986627 Original CRISPR GGTTACTATAGACAGTGGGT TGG (reversed) Intergenic
No off target data available for this crispr