ID: 1153989318

View in Genome Browser
Species Human (GRCh38)
Location 18:10381915-10381937
Sequence CACCATTCACAGGCTGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153989315_1153989318 -10 Left 1153989315 18:10381902-10381924 CCACAAATTTCAGCACCATTCAC No data
Right 1153989318 18:10381915-10381937 CACCATTCACAGGCTGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153989318 Original CRISPR CACCATTCACAGGCTGGCCA TGG Intergenic
No off target data available for this crispr