ID: 1153989840

View in Genome Browser
Species Human (GRCh38)
Location 18:10386411-10386433
Sequence CCTTACAAGCTCATTCCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153989840_1153989843 18 Left 1153989840 18:10386411-10386433 CCCTGAGGAATGAGCTTGTAAGG No data
Right 1153989843 18:10386452-10386474 GTCAGCACTACAATGCCGCTTGG No data
1153989840_1153989844 24 Left 1153989840 18:10386411-10386433 CCCTGAGGAATGAGCTTGTAAGG No data
Right 1153989844 18:10386458-10386480 ACTACAATGCCGCTTGGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153989840 Original CRISPR CCTTACAAGCTCATTCCTCA GGG (reversed) Intergenic
No off target data available for this crispr