ID: 1153990941

View in Genome Browser
Species Human (GRCh38)
Location 18:10399842-10399864
Sequence CTGTAAATATCTATGAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153990939_1153990941 1 Left 1153990939 18:10399818-10399840 CCCATTTCTTTTCTTGGTGACAT No data
Right 1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG No data
1153990940_1153990941 0 Left 1153990940 18:10399819-10399841 CCATTTCTTTTCTTGGTGACATG No data
Right 1153990941 18:10399842-10399864 CTGTAAATATCTATGAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153990941 Original CRISPR CTGTAAATATCTATGAAAAT AGG Intergenic
No off target data available for this crispr