ID: 1153994833

View in Genome Browser
Species Human (GRCh38)
Location 18:10431864-10431886
Sequence GATTAACTATGAGCACGTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153994830_1153994833 4 Left 1153994830 18:10431837-10431859 CCATCCAAAATGATCATTCCTTC No data
Right 1153994833 18:10431864-10431886 GATTAACTATGAGCACGTCAAGG No data
1153994831_1153994833 0 Left 1153994831 18:10431841-10431863 CCAAAATGATCATTCCTTCAAAT No data
Right 1153994833 18:10431864-10431886 GATTAACTATGAGCACGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153994833 Original CRISPR GATTAACTATGAGCACGTCA AGG Intergenic
No off target data available for this crispr