ID: 1153994991

View in Genome Browser
Species Human (GRCh38)
Location 18:10432997-10433019
Sequence GAGTGTTGCAAGGCTGCTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153994991_1153994996 14 Left 1153994991 18:10432997-10433019 CCTCAAGCAGCCTTGCAACACTC No data
Right 1153994996 18:10433034-10433056 GAGTTCTCAAAGATTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153994991 Original CRISPR GAGTGTTGCAAGGCTGCTTG AGG (reversed) Intergenic
No off target data available for this crispr