ID: 1153994996

View in Genome Browser
Species Human (GRCh38)
Location 18:10433034-10433056
Sequence GAGTTCTCAAAGATTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153994992_1153994996 4 Left 1153994992 18:10433007-10433029 CCTTGCAACACTCCCATTGTGTC No data
Right 1153994996 18:10433034-10433056 GAGTTCTCAAAGATTGTGTTTGG No data
1153994994_1153994996 -9 Left 1153994994 18:10433020-10433042 CCATTGTGTCCACAGAGTTCTCA No data
Right 1153994996 18:10433034-10433056 GAGTTCTCAAAGATTGTGTTTGG No data
1153994991_1153994996 14 Left 1153994991 18:10432997-10433019 CCTCAAGCAGCCTTGCAACACTC No data
Right 1153994996 18:10433034-10433056 GAGTTCTCAAAGATTGTGTTTGG No data
1153994993_1153994996 -8 Left 1153994993 18:10433019-10433041 CCCATTGTGTCCACAGAGTTCTC No data
Right 1153994996 18:10433034-10433056 GAGTTCTCAAAGATTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153994996 Original CRISPR GAGTTCTCAAAGATTGTGTT TGG Intergenic
No off target data available for this crispr