ID: 1153997537

View in Genome Browser
Species Human (GRCh38)
Location 18:10454862-10454884
Sequence CCTGAAGCCCCGGCCTGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 492
Summary {0: 1, 1: 0, 2: 1, 3: 58, 4: 432}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153997517_1153997537 26 Left 1153997517 18:10454813-10454835 CCCCGCAGCCCCGCGCCTAGCCC 0: 1
1: 0
2: 4
3: 40
4: 439
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997523_1153997537 17 Left 1153997523 18:10454822-10454844 CCCGCGCCTAGCCCGCCGGGCAT 0: 1
1: 0
2: 0
3: 9
4: 49
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997519_1153997537 24 Left 1153997519 18:10454815-10454837 CCGCAGCCCCGCGCCTAGCCCGC 0: 1
1: 0
2: 2
3: 39
4: 444
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997532_1153997537 2 Left 1153997532 18:10454837-10454859 CCGGGCATGGGGCGCGCGGCAGC 0: 1
1: 0
2: 0
3: 15
4: 163
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997518_1153997537 25 Left 1153997518 18:10454814-10454836 CCCGCAGCCCCGCGCCTAGCCCG 0: 1
1: 1
2: 1
3: 34
4: 321
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997531_1153997537 5 Left 1153997531 18:10454834-10454856 CCGCCGGGCATGGGGCGCGCGGC 0: 1
1: 0
2: 1
3: 5
4: 141
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997524_1153997537 16 Left 1153997524 18:10454823-10454845 CCGCGCCTAGCCCGCCGGGCATG 0: 1
1: 0
2: 0
3: 9
4: 81
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997528_1153997537 11 Left 1153997528 18:10454828-10454850 CCTAGCCCGCCGGGCATGGGGCG 0: 1
1: 0
2: 0
3: 8
4: 103
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997529_1153997537 6 Left 1153997529 18:10454833-10454855 CCCGCCGGGCATGGGGCGCGCGG 0: 1
1: 0
2: 1
3: 26
4: 209
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432
1153997522_1153997537 18 Left 1153997522 18:10454821-10454843 CCCCGCGCCTAGCCCGCCGGGCA 0: 1
1: 0
2: 0
3: 10
4: 123
Right 1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG 0: 1
1: 0
2: 1
3: 58
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153997537 Original CRISPR CCTGAAGCCCCGGCCTGGCC CGG Exonic
900090855 1:919829-919851 CCTGCAGCCTGGACCTGGCCCGG - Intergenic
900124675 1:1064152-1064174 CTGGAGGCCACGGCCTGGCCAGG - Intergenic
900130830 1:1086468-1086490 CCAGCAGCCCTGGCCTGTCCTGG - Intronic
900290306 1:1920926-1920948 CCTGCGGCCGGGGCCTGGCCTGG + Intergenic
900555267 1:3277153-3277175 CCCGAAGCCTCCTCCTGGCCTGG - Intronic
900609833 1:3539825-3539847 CCTGGGACCCTGGCCTGGCCCGG - Intronic
900634149 1:3653363-3653385 CCTGCAGCCCCTGCCTTTCCCGG + Intronic
900916056 1:5639478-5639500 CCTGAGACCCCTGCCTGGGCTGG - Intergenic
901465575 1:9418883-9418905 GCTGAGGCCCTGCCCTGGCCTGG + Intergenic
901526406 1:9825483-9825505 CCCAAAGCACCTGCCTGGCCCGG + Intergenic
901857645 1:12054506-12054528 CCTGAAGGCCCAGTCTGGCCTGG - Intergenic
902217048 1:14940838-14940860 CCAGTAGCCTGGGCCTGGCCAGG + Intronic
902219526 1:14956183-14956205 CTTCAAACCCAGGCCTGGCCGGG - Intronic
902529425 1:17081029-17081051 CTTGAGGCCCAGGCCAGGCCCGG - Intronic
902813852 1:18904839-18904861 ACTGCAGCCCAGGCTTGGCCTGG + Exonic
902872705 1:19324172-19324194 CCTGGAGACCCGGCGTGCCCAGG + Intronic
902874277 1:19331622-19331644 CCCGAAGCCCCAGCTTGCCCTGG + Intergenic
902955929 1:19924047-19924069 CAGGAGGCCCTGGCCTGGCCTGG + Intergenic
903339345 1:22644138-22644160 CCTGGTGCCCCGGGCAGGCCGGG - Exonic
903384844 1:22919538-22919560 GCTGGAGGCCCCGCCTGGCCAGG - Intergenic
903948216 1:26977703-26977725 CCTGAAGTCCTGTCCTGGGCAGG - Intergenic
904598959 1:31663423-31663445 CCAGATGCCCTGGCCAGGCCAGG - Intronic
904602843 1:31683341-31683363 CCTGGAGCCCCGGGTTTGCCTGG - Exonic
904744745 1:32703540-32703562 CCTGAAGCCCAGGTCTGGGAAGG - Intronic
905115976 1:35641299-35641321 CCTACACCCCAGGCCTGGCCGGG + Intronic
905170152 1:36105097-36105119 CCTCAAGCCCAGACCTAGCCTGG - Intronic
905403229 1:37717669-37717691 TCTCATGGCCCGGCCTGGCCAGG + Exonic
906059096 1:42936649-42936671 CCGGGAGGCCTGGCCTGGCCTGG - Intronic
906480786 1:46197846-46197868 CCTGAAGTCATGGGCTGGCCAGG - Exonic
907815058 1:57910606-57910628 CCTGGAGCCACGTCGTGGCCTGG + Intronic
908684083 1:66695126-66695148 GCTGACGCCCCTGCATGGCCAGG + Intronic
908942405 1:69451402-69451424 ACTGAATCCCCAGCCTGGCCTGG + Intergenic
912332710 1:108834417-108834439 CCTGCAGCCGGGGCCTGGCTGGG - Intronic
912717535 1:111992339-111992361 CCTCTGGTCCCGGCCTGGCCGGG + Intergenic
913222143 1:116667876-116667898 CCTCATGCCCCCGCCAGGCCCGG - Intergenic
914815493 1:151059426-151059448 CCTGCCGCGCCGGCCGGGCCAGG - Exonic
915118811 1:153616064-153616086 CCTGAAGCCCAGGCGGGGCCTGG - Intronic
916439369 1:164807710-164807732 CCGGAGGCCCCGCCATGGCCAGG - Intronic
917851577 1:179069133-179069155 CCTGAAGCCTTAGCCTGGCCTGG - Intronic
918100118 1:181365654-181365676 CCTGAAGCCAGGGTCTGGACAGG + Intergenic
918898571 1:190381396-190381418 CCTGAAGCTCAGGGCTGGCTTGG - Intronic
919377049 1:196808226-196808248 CCTGAAGGCCCGGTTAGGCCAGG - Intergenic
919386752 1:196933117-196933139 CCTGAAGGCCCGGTTAGGCCAGG - Intronic
919857947 1:201718486-201718508 CCTGCAGCCGCGGACTGGACTGG - Exonic
920183097 1:204144568-204144590 CCTAAAGCCCAGTCCTGGTCAGG + Intronic
921014294 1:211173719-211173741 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
922499124 1:226083748-226083770 CCTGAGGCCTCAGCCTCGCCGGG + Intergenic
922721478 1:227902183-227902205 CCTGATGGCCAGGCCAGGCCAGG + Intergenic
923105297 1:230849526-230849548 ACTGACGCCCAGCCCTGGCCTGG - Intronic
923352000 1:233117339-233117361 CCACAACCCCCGGCCTGGCGCGG + Intronic
924261645 1:242237638-242237660 CTTGCAGCCCTGGCCTGGGCTGG + Intronic
924775454 1:247112293-247112315 CCTGGAGCCCGAGCATGGCCGGG - Exonic
1062767484 10:76537-76559 CCCGAAGCCCCGGCCCCTCCGGG + Intergenic
1062841597 10:677762-677784 CATAAAGCCCCAGCCTGGCCAGG + Intronic
1064086398 10:12349323-12349345 CCTGGAGCCCCGGCGAGGGCGGG - Intergenic
1064088114 10:12360876-12360898 TCTGCAGTCCCGGCCTGGCCCGG - Intronic
1067223650 10:44361716-44361738 TCTGAATCCCTGGCCTGGCCTGG - Intergenic
1069604026 10:69728801-69728823 CATGAAGCCCCAGCCTGCCAAGG - Intergenic
1069775334 10:70923896-70923918 CCTCCAGCCCTGCCCTGGCCTGG - Intergenic
1069895013 10:71675058-71675080 CCTGAAGCCTCAGCTGGGCCTGG + Intronic
1069921449 10:71818141-71818163 ACTGTGGCCCTGGCCTGGCCTGG - Intronic
1070281098 10:75049485-75049507 CCTGAGGCCCTGGCCTGGCCTGG - Intronic
1070727576 10:78802803-78802825 CCAGCAGTCCCTGCCTGGCCTGG - Intergenic
1071496364 10:86170099-86170121 CCTCAAGCCCCAGGCTTGCCTGG - Intronic
1071567637 10:86680013-86680035 CCAGAAGCTCCTGCCTGGGCAGG - Intronic
1073285526 10:102385286-102385308 CCTGAAGTCCAGGCCATGCCTGG + Intergenic
1073292766 10:102421519-102421541 GCTGAAGCCCCGCCCCTGCCTGG + Intronic
1074277910 10:112022469-112022491 CCTGAAGCCTTGGCCTGGGCTGG - Intergenic
1074385904 10:113016570-113016592 CCTGAAGCTCCGGCAGAGCCTGG + Intronic
1075468048 10:122666148-122666170 CCTGCAGCCCTGGCCAGACCAGG - Intergenic
1076023007 10:127089613-127089635 CCTGAAGCCTGGACTTGGCCAGG - Intronic
1076156718 10:128210731-128210753 CCTGCGGCCCCTGCCTGTCCCGG + Intergenic
1076368212 10:129935777-129935799 CCTGAGGCCCCGGTGTGGCAGGG - Intronic
1076671037 10:132121225-132121247 CCTGCAGCTCCTGCCAGGCCCGG - Intronic
1076720660 10:132391215-132391237 CGGGAGGCCCCTGCCTGGCCTGG - Intergenic
1076750037 10:132537926-132537948 GCCGGAGCCCCGGCCAGGCCCGG + Exonic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1077103531 11:832484-832506 CCTGGAGACCCGGGCAGGCCTGG - Intergenic
1077168379 11:1153804-1153826 CCTGAGGCCTCGGCCTGGTGGGG + Intergenic
1077236965 11:1486510-1486532 CCTGAAGACCAAGCCCGGCCCGG - Exonic
1077283041 11:1754155-1754177 CGTGAAGCCCCTGCCGGGACTGG + Intronic
1077547872 11:3183708-3183730 GCTGCAGGCCCGGCCTGGCCCGG - Intergenic
1078270989 11:9794377-9794399 ACTTAAGACCAGGCCTGGCCAGG + Intronic
1078600352 11:12724880-12724902 CCGGAAGCACAGGCCTCGCCAGG - Intronic
1080022885 11:27581922-27581944 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1080395152 11:31883156-31883178 CCTGCAGCCCGGGTCTGGCTGGG + Intronic
1080540139 11:33257481-33257503 CCTGACGCCCCGGCCGGGAGCGG - Intronic
1081667470 11:44925011-44925033 ACTGATGTCCTGGCCTGGCCTGG + Intronic
1081864576 11:46352497-46352519 CCTGAGGCCCAGGCCCAGCCAGG + Intronic
1083170529 11:60921793-60921815 CCTGAAGCTCAGCCCTGGCCAGG + Exonic
1083260096 11:61518180-61518202 CGTTTGGCCCCGGCCTGGCCAGG - Exonic
1083479270 11:62933426-62933448 CCTGATGCCCCGCCCTTCCCTGG - Intergenic
1083634852 11:64115065-64115087 CCTGAAGTCCCAGCCTGGGAGGG - Intronic
1083952866 11:65966472-65966494 CCTGCAGCCGCAGCTTGGCCCGG - Exonic
1084151328 11:67289250-67289272 CGCGAAGCCCCGCCCCGGCCCGG + Intronic
1084438165 11:69156052-69156074 CCTGGAGCCCCTGCCTGGACTGG - Intergenic
1084593998 11:70106417-70106439 CCAGAAAGCCCAGCCTGGCCGGG + Intronic
1085030077 11:73265691-73265713 CCTGCAGCCCCTTCCTGCCCAGG - Intronic
1085299596 11:75450397-75450419 CCTGAGGCCTGGGCATGGCCTGG - Intronic
1085317685 11:75555293-75555315 CCCGAGGCCCCTGCCTGGTCTGG + Intergenic
1085351807 11:75802565-75802587 CCAGAAGCCCCAGCCTGCCCGGG + Intergenic
1085396799 11:76210506-76210528 CCGGGTGCCCCGGCCTGCCCAGG + Intronic
1085524848 11:77158152-77158174 CCTGGGGCCCCGGGCTGGCCTGG + Intronic
1086370579 11:86151885-86151907 CCTCCAGCCCCAGCCTGGGCTGG + Intergenic
1087608637 11:100407459-100407481 ATTGTAGCCCCGGTCTGGCCTGG - Intergenic
1089299658 11:117490908-117490930 CCTCCAGCCCCAGCCTGCCCTGG - Intronic
1089513601 11:119017377-119017399 CCTGAAGGGCTGCCCTGGCCAGG + Exonic
1090338563 11:125993743-125993765 CCTGAAGGCCCCACCTGACCTGG - Intronic
1090356936 11:126146643-126146665 CCTGGAGGCCCAGCCAGGCCTGG - Intergenic
1090426664 11:126611783-126611805 CCTGAAGCATCAGCCTGGCGGGG - Intronic
1091133352 11:133165402-133165424 CCTGGAGACCCTCCCTGGCCAGG + Intronic
1091705173 12:2688717-2688739 CCTGGGGCCCCAGCCTGGCTGGG - Exonic
1091928002 12:4371019-4371041 CCTGGAGGCCCGGGCTGGCCTGG + Intronic
1092172864 12:6384378-6384400 CCTCTGCCCCCGGCCTGGCCTGG + Exonic
1094041521 12:26125136-26125158 CCCGACGCCCCCGCCCGGCCCGG - Intronic
1095990233 12:48029546-48029568 CCTGCAGCCCCAGTCAGGCCAGG - Intergenic
1096679761 12:53247820-53247842 GCTGAAGCCCAGGACTGGGCTGG + Intergenic
1096718578 12:53505302-53505324 CCTGGAGCCCTGCCCTGGCATGG - Intronic
1096847737 12:54417415-54417437 CCTGGAGCCTCTGCCAGGCCTGG - Intronic
1098441690 12:70525816-70525838 CCTGATGGCTCAGCCTGGCCTGG - Intronic
1100397365 12:94196703-94196725 CCTCGAGTCCAGGCCTGGCCAGG + Intronic
1102151186 12:110689728-110689750 CGTGCAGCCCCTGCCTGTCCTGG + Intronic
1103562661 12:121800465-121800487 CCGGAAGCCGCGGACCGGCCTGG - Intronic
1103927872 12:124433718-124433740 CGGGCAGCTCCGGCCTGGCCTGG + Intronic
1104001611 12:124863923-124863945 CCTGAAGCCCAAGGCTGCCCGGG - Intronic
1104775744 12:131389267-131389289 CCTGAGGCCCCGGGCTGAGCTGG + Intergenic
1104929163 12:132329251-132329273 GCTGAAGCCCAGGCCCGGGCGGG - Intronic
1105330228 13:19409262-19409284 CCTGGAGCCCCAGCCTGACAGGG + Intergenic
1105403881 13:20118454-20118476 CCTGAGCACCCGGCCTGCCCAGG + Intergenic
1105408640 13:20151578-20151600 CCTGGAGCCCCGGTCTGCTCTGG - Intronic
1105599068 13:21869677-21869699 CCTAGAGCCCCGGCCTAGGCAGG + Intergenic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105861577 13:24419792-24419814 CCTGGAGCCCCAGCCTGTCAGGG - Intergenic
1105918312 13:24938087-24938109 CCTGGAGCCCCAGCCTGTCAGGG + Intergenic
1112385113 13:98932015-98932037 CCTGAAGCCCAGGCCGGGCATGG - Intronic
1113372262 13:109734245-109734267 CCTGCCGCCCCTGCCTGGCCTGG - Intergenic
1113592937 13:111513336-111513358 GCTGCACCCCTGGCCTGGCCAGG - Intergenic
1113906514 13:113821862-113821884 CCAGAAACCCCAGCCTGTCCAGG + Intronic
1113936566 13:113998030-113998052 CCTGAGGCCACTGCCAGGCCAGG - Intronic
1113961343 13:114127985-114128007 CCTGGGGCCCGGGCCTTGCCTGG - Intronic
1114483216 14:23047962-23047984 CCTGAGCGCCCGGGCTGGCCCGG - Exonic
1115993211 14:39170547-39170569 CCTAAAGCTCCCGCCTGGCCCGG + Intergenic
1121439881 14:93941940-93941962 CCTGAAGCCCAGGCTTGGGGTGG + Intronic
1121444450 14:93969748-93969770 CCTGAAGGCCCTGCGGGGCCAGG - Intronic
1122255349 14:100472205-100472227 CCTGGAGCCCCGGCTGGGCAGGG + Intronic
1122640223 14:103155476-103155498 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640236 14:103155512-103155534 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122640250 14:103155548-103155570 CCTGGGGTCCCGGCCTGTCCTGG - Intergenic
1122854490 14:104553589-104553611 CCTCAGTCCCCTGCCTGGCCTGG - Intronic
1122898538 14:104772492-104772514 CCTGAACCCAGGGCCTGGGCAGG - Intronic
1122934401 14:104949297-104949319 CCTGAAGGTCCAGACTGGCCAGG - Exonic
1123107237 14:105847663-105847685 CCCAAAGCCCAGGCCGGGCCTGG + Intergenic
1123109892 14:105861460-105861482 CCCAAAGCCCAGGCCGGGCCTGG + Intergenic
1202849697 14_GL000225v1_random:9043-9065 CCTGCAGGCACGGCCTGGCTGGG - Intergenic
1123964230 15:25439065-25439087 CCTGGAGCCCTCGCCCGGCCGGG - Intergenic
1124577600 15:30923609-30923631 CAGCCAGCCCCGGCCTGGCCAGG + Intronic
1124618006 15:31256507-31256529 CTTGAAGCCCCGGGCTCCCCAGG - Intergenic
1124637621 15:31375061-31375083 CCTTAGGCCCCGGCCTGGACTGG + Exonic
1125484609 15:40103531-40103553 CGTGATGCCCCGCCCTGGCGGGG + Intronic
1125832946 15:42729228-42729250 CCTGCAGCCCCTGGCTGGTCTGG + Exonic
1128526179 15:68414001-68414023 CCAGAAGCCCCAGCCAGGGCAGG - Intronic
1129460307 15:75697086-75697108 CCTGAGACCCGGCCCTGGCCTGG - Intronic
1129890547 15:79068969-79068991 CCTGGACCACAGGCCTGGCCGGG + Intronic
1130305327 15:82709427-82709449 CCTGGAGCCCCGGCCCAGCGCGG - Intronic
1130415769 15:83693386-83693408 CCTCCAGCTCCAGCCTGGCCAGG - Intronic
1130992935 15:88887318-88887340 CCTGGGGCCCCAGCCTGGCCCGG - Exonic
1131020190 15:89090935-89090957 CCAGCAGCGCCTGCCTGGCCTGG + Intronic
1132356398 15:101174327-101174349 CCTGCAGCCCCTGCTGGGCCTGG - Intergenic
1132366878 15:101264284-101264306 GCTGAAGCCCAGCCCAGGCCTGG + Intergenic
1132467332 16:83374-83396 CCCGAAACCCTGGCCTGGCCTGG - Intronic
1132553180 16:561495-561517 GCTGCAGACCCGGCCTGGACTGG - Intronic
1132662447 16:1067640-1067662 CCTCAATCCCCAGCATGGCCCGG - Intergenic
1132727496 16:1345330-1345352 CCTGAAGCCTCCACTTGGCCTGG - Exonic
1132804594 16:1769643-1769665 CCTGAGGCCTGGGCCTGCCCTGG - Exonic
1132903885 16:2272355-2272377 GTTCAAGCCCCGGGCTGGCCTGG + Intergenic
1133073760 16:3264168-3264190 CCGGCAGCCCCTCCCTGGCCCGG + Intronic
1133729676 16:8568959-8568981 CCAGAAGCCTCGGCATCGCCTGG + Intergenic
1134070470 16:11256749-11256771 CCCGAAGCCCCGGCCGGCCGCGG + Intronic
1134216615 16:12321431-12321453 CCTCACTCCCAGGCCTGGCCTGG - Intronic
1136479911 16:30534684-30534706 CCGCATGCCCAGGCCTGGCCAGG - Exonic
1136843595 16:33558539-33558561 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1137670312 16:50274657-50274679 CCTGAAGCCACCACCTGGCCCGG - Intronic
1138113099 16:54340058-54340080 CCAGTAGCTCCAGCCTGGCCTGG - Intergenic
1138230320 16:55331540-55331562 CTGGAAGGCCTGGCCTGGCCGGG - Intergenic
1139505299 16:67395496-67395518 GCTGCTGGCCCGGCCTGGCCAGG + Exonic
1139878255 16:70163705-70163727 CCTGGAGACCCTGGCTGGCCAGG - Intergenic
1140359308 16:74331109-74331131 CCTGGAGACCCTGGCTGGCCAGG + Intergenic
1141131957 16:81443533-81443555 CCTGAAACCCTGGCCAGGCTCGG + Intergenic
1141927041 16:87176899-87176921 CCTGAAGCCCAGGCCTGCCTCGG - Intronic
1141989888 16:87603543-87603565 CCTCCCGCCCCGGCCCGGCCCGG - Intronic
1142065470 16:88059889-88059911 CCTGGAGCCACGGCCTGGTGGGG + Intronic
1142140175 16:88469237-88469259 TCTGAAGTGCCGGCCGGGCCAGG + Intronic
1142238294 16:88933156-88933178 CCTGTGGCCCCGGCCCTGCCTGG + Intronic
1142262130 16:89048008-89048030 CCTGACGGCCCTGCCTGGCCAGG - Intergenic
1142317947 16:89361028-89361050 CCTGGAGCCCAGGGCTGCCCAGG - Intronic
1142355575 16:89600057-89600079 GCAGCAGCCCCTGCCTGGCCAGG - Intergenic
1203148754 16_KI270728v1_random:1820651-1820673 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1203153760 16_KI270728v1_random:1858837-1858859 CCTGAAAGCCAGGTCTGGCCAGG - Intergenic
1142493291 17:292601-292623 CCTGCTGCCCCAGCCGGGCCTGG + Intronic
1142559321 17:800688-800710 CATGCAGCCCCGCTCTGGCCGGG + Exonic
1142614029 17:1124815-1124837 CATGCAGCCACTGCCTGGCCTGG + Intronic
1143007847 17:3848396-3848418 CCTGATGTCCCGGCTTGTCCTGG - Intergenic
1143240458 17:5439148-5439170 CCGGAAGCCCCGCCCCTGCCCGG + Exonic
1143670549 17:8393082-8393104 CCTGGCGGCCTGGCCTGGCCTGG + Exonic
1143725584 17:8843008-8843030 CCTGAAGCCCCCACTTGGCAAGG + Intronic
1143858818 17:9872974-9872996 CCTGGGGAGCCGGCCTGGCCTGG + Intronic
1144345935 17:14349730-14349752 ACTGAAGCCGCTGCCTGCCCCGG + Intergenic
1144816695 17:18039910-18039932 CCTCGGGCCCCGGCCCGGCCCGG - Intronic
1144857034 17:18274953-18274975 TCTGGAGCCCCGTCCTGGACAGG - Exonic
1145935210 17:28711223-28711245 CTTGAAGCGCCGGCCTTGGCTGG - Intronic
1147190666 17:38736201-38736223 CCTGGAGCCCCGAGCTGGCCAGG - Intronic
1147265557 17:39232262-39232284 CCTGAACCCCTGGGCTGCCCCGG - Intergenic
1147458887 17:40555980-40556002 CCTGCAGCCTCGGCCTCTCCAGG + Intronic
1147560768 17:41507539-41507561 CCTGAATCCCTGGCCTCGCAAGG - Intergenic
1147769611 17:42858429-42858451 CCAGAAGCCCAGGCCAGGGCAGG + Intergenic
1147824423 17:43261381-43261403 CCTAAAGCCCCCCCGTGGCCAGG + Intergenic
1147867205 17:43560845-43560867 CCTGTAGCAGCGGCCTGCCCTGG - Intronic
1147967035 17:44199312-44199334 CCAGGGGCCCCGGCCCGGCCGGG + Intronic
1148082982 17:44977688-44977710 CCTCCATCCCCGCCCTGGCCAGG - Intergenic
1148331556 17:46816945-46816967 CCTGAAGTCCCTGGCTGCCCTGG + Intronic
1148560402 17:48602667-48602689 CCTGGAGCCCCGGCCTCGCAGGG - Intronic
1148855310 17:50575947-50575969 CCTGGATCTCCGGGCTGGCCCGG - Exonic
1150139162 17:62714114-62714136 TGTGAAGCACAGGCCTGGCCTGG - Intronic
1150610250 17:66727768-66727790 CCTGAAGACCCAGCCTTCCCTGG - Intronic
1151265009 17:72948018-72948040 CCTGAAGACCCAGCATGGCCTGG - Intronic
1151302731 17:73239809-73239831 TCTGAAGCTCAGGCCAGGCCTGG - Intronic
1151763662 17:76121581-76121603 CCTCGCGGCCCGGCCTGGCCCGG - Intergenic
1151938937 17:77281146-77281168 CCCCCACCCCCGGCCTGGCCTGG + Intronic
1152528559 17:80903438-80903460 CCTGCACCCCAGGCCTGCCCAGG + Intronic
1152576571 17:81143805-81143827 CCTGGAGCCCCGGGCAGGCAGGG - Intronic
1152621282 17:81366133-81366155 CCTGCAGCCCAGGGCAGGCCTGG - Intergenic
1152685311 17:81690921-81690943 CCTGATGCCACTGCCTGGGCCGG + Intronic
1152695564 17:81742067-81742089 CCTGGAGGCTCGCCCTGGCCAGG + Intergenic
1152899640 17:82933016-82933038 CCTGAGGCCCACCCCTGGCCCGG - Intronic
1152960319 18:75883-75905 CCCGAAGCCCCGGCCCCTCCGGG + Intergenic
1153997537 18:10454862-10454884 CCTGAAGCCCCGGCCTGGCCCGG + Exonic
1155153718 18:23141605-23141627 CCACAGGCCCCCGCCTGGCCTGG - Intronic
1156586242 18:38434059-38434081 CCTCATGCCCTGGCCTGGTCAGG + Intergenic
1157299238 18:46467740-46467762 CCTGCAGCCTCAGCATGGCCTGG + Intergenic
1157598717 18:48879439-48879461 CAGGAAGCCCCTCCCTGGCCAGG + Intergenic
1157706655 18:49813396-49813418 CCGGAAGCGGAGGCCTGGCCTGG + Intronic
1157847782 18:51019504-51019526 CCTGAAGCCAGGGCCTGGGAGGG - Intronic
1158193590 18:54859068-54859090 CCTGAAGCCTACTCCTGGCCAGG - Intronic
1160010674 18:75105360-75105382 CCTGAAGCCCAGGACTCACCCGG - Intergenic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160862326 19:1242635-1242657 TGTGGAGCCCCAGCCTGGCCTGG - Intronic
1160903488 19:1440845-1440867 CCTCAAGCCCTCACCTGGCCTGG + Exonic
1160923043 19:1529503-1529525 CCTGCAGCCCCGGGCTGGGACGG - Intronic
1161065892 19:2237063-2237085 CCTGAGGCCCCGCGCTGGGCGGG + Intronic
1161080399 19:2307565-2307587 GCTGACGGCCCGGCCTGGCGGGG - Intronic
1161513651 19:4684893-4684915 TCTGAGGCCCCAGCCCGGCCCGG - Intronic
1161588574 19:5118447-5118469 CCCTAAGCCCTGGCCTGGCCAGG - Intronic
1161715885 19:5876186-5876208 CCTGGAGCCCCAGCCAAGCCTGG + Intronic
1162056322 19:8066158-8066180 CCTGGAGCTCCGGCCGGCCCTGG - Exonic
1162271749 19:9621497-9621519 CCTGAACCACCGGCTAGGCCGGG - Exonic
1162378145 19:10316952-10316974 CTTCAAGGCCCGGCCTGTCCGGG - Exonic
1162908297 19:13836247-13836269 CCTGCAGCCCCTGCCTTCCCTGG - Intergenic
1163015325 19:14451035-14451057 CCTTCAGCACCCGCCTGGCCGGG + Exonic
1163249151 19:16115898-16115920 CTTGAGGCCCAGGCCTGGCTGGG - Intronic
1163370376 19:16897853-16897875 CCCGCACCCCCGGCCCGGCCCGG - Intronic
1163697275 19:18770211-18770233 TCTGAATCCGGGGCCTGGCCTGG + Intronic
1164469177 19:28514187-28514209 GCAGAAGCCCCAGCCTGGGCTGG - Intergenic
1164992197 19:32692431-32692453 CCTGGAGCCACCGCCGGGCCTGG + Exonic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1167125471 19:47545633-47545655 TCTGAAGCCCCCGCCGGGGCTGG + Exonic
1167352923 19:48986845-48986867 CATGAATCCCCAGCCTGACCTGG - Intronic
1168307370 19:55442810-55442832 CCTCTAGCGCCGGCCAGGCCAGG - Exonic
1168402054 19:56090882-56090904 GCTGAAGCACAGGCCCGGCCCGG - Intronic
925090991 2:1155974-1155996 CCAGAAGGCCAGGCCAGGCCAGG + Intronic
925224679 2:2172803-2172825 CCAGAAGCCCCGTGCTGGGCAGG + Intronic
926474696 2:13308253-13308275 CCTGCAGCCCGGGTCTGGGCGGG - Intergenic
927638597 2:24833049-24833071 CCTCTATCCTCGGCCTGGCCTGG + Intronic
927880273 2:26685438-26685460 CCTGAGGTCCAGGCCTGGGCAGG - Intergenic
928980373 2:37130382-37130404 CGTGAGGCACCGACCTGGCCTGG + Intronic
931566812 2:63622901-63622923 CGCCGAGCCCCGGCCTGGCCCGG - Intronic
932346893 2:71001489-71001511 CCTGCTGCCCCGGCATGGTCTGG + Intergenic
932441200 2:71736737-71736759 TCTGAAGCACGGGCCAGGCCTGG + Intergenic
932573814 2:72951872-72951894 CCTGAGGCCTCTGCCAGGCCTGG + Intronic
933808644 2:86018226-86018248 TCTGAAGGCCTGGCCTGGGCGGG - Intergenic
934563563 2:95325467-95325489 CCTGAACCTCCTGCCTGGCCAGG - Intronic
935372869 2:102365841-102365863 TCTGAAGCCACAGCCTGACCTGG + Intronic
936068114 2:109347586-109347608 TGAGAAGCCCCGGCCTGCCCCGG + Intronic
936600411 2:113889927-113889949 GCCGACGCCCCGGCCAGGCCAGG - Intergenic
937222312 2:120348874-120348896 CCTCCAGCCCCAGCCTGGTCCGG + Intronic
937252521 2:120533743-120533765 CCTGAGCCCCCGGCGTGGACAGG + Intergenic
937950933 2:127387641-127387663 CATGAAGCCCGGGCCGGGCGGGG + Intronic
938407978 2:131043328-131043350 CCTGCAGCGCCCACCTGGCCAGG - Intronic
938466628 2:131529360-131529382 CCTAAAGCCCAGGCCCTGCCTGG + Intronic
940830016 2:158456884-158456906 CCGGGAGCCCGGGGCTGGCCGGG + Intergenic
940851502 2:158691603-158691625 TCTGGAGCCCAGGGCTGGCCTGG - Intergenic
942448338 2:176092874-176092896 GCTCATGGCCCGGCCTGGCCCGG - Exonic
942578680 2:177393088-177393110 CCTGCAGCACAGGCCCGGCCTGG - Intronic
943002131 2:182341534-182341556 CCAGAAACTCCAGCCTGGCCTGG + Intronic
946340219 2:219061378-219061400 CCTGGTGCCCCACCCTGGCCCGG + Intergenic
946351938 2:219160867-219160889 CCAGAAGCCCCGCCCACGCCAGG - Intronic
947712034 2:232321851-232321873 CCTGCAGCCACCGCCTGGCTGGG - Intronic
947731274 2:232432970-232432992 CCTGCAGCCACCGCCTGGCTGGG - Intergenic
948046829 2:234951873-234951895 CCCGAAGCCCCGCCCCGGCGCGG + Intergenic
948116164 2:235495210-235495232 CAAGACGCCCAGGCCTGGCCTGG - Intronic
948801688 2:240436103-240436125 CCGGGAACCCGGGCCTGGCCGGG + Intronic
948806583 2:240455822-240455844 CCTGTGGCCCCGGCCTGCGCCGG + Intronic
1169001726 20:2172833-2172855 TCTGAAGACCCTGCCTGGGCAGG - Intronic
1169008601 20:2230859-2230881 CCTGGAGCCAGGGCCTGGCTAGG + Intergenic
1169194205 20:3674627-3674649 CTTGGAGCCCCGGGGTGGCCAGG + Exonic
1171983714 20:31644925-31644947 CCTGAGGCTCCGCCCTGGCTGGG + Exonic
1172440913 20:34965919-34965941 CCTGGAGACCCAGCCTGACCTGG - Intergenic
1172600567 20:36179908-36179930 CCAGGAGCCCCAGCCTGGCTGGG + Intronic
1173162741 20:40664381-40664403 CCTGATGGCCTGGCCTGGCCTGG + Intergenic
1173618483 20:44418525-44418547 CCTGGAGCCCTGGCCAGGGCAGG - Intronic
1173838376 20:46140194-46140216 CCAGAGGCACCGGCCTGGCAGGG + Intergenic
1174052724 20:47778533-47778555 CAAGAAGCCCTGGCCTGGGCTGG + Intronic
1174488673 20:50876969-50876991 CCATCAGCCCCGGCCAGGCCTGG - Exonic
1175544819 20:59771404-59771426 CCTGCAGCCCCTGCCCTGCCTGG + Intronic
1175863903 20:62164358-62164380 CCTGTAGCCCAGGCCTGAGCTGG - Intronic
1175920908 20:62450302-62450324 CCTGAAGACCCTGCCAGCCCTGG - Intergenic
1176100380 20:63361843-63361865 CCTGCAGCCCCCGCCTTCCCTGG + Intronic
1176952619 21:15064801-15064823 CCTGCCGCCCCGTCCTGGCCCGG + Exonic
1179243188 21:39609652-39609674 CCTGAAGTCCCGTTCTGGCAGGG + Exonic
1179615209 21:42579201-42579223 CTTGGAGGCCAGGCCTGGCCGGG - Intronic
1179878120 21:44281748-44281770 CCAGGAGCCAAGGCCTGGCCAGG + Intergenic
1179902366 21:44400829-44400851 GTTGAAGACCTGGCCTGGCCTGG + Intronic
1180158645 21:45989506-45989528 CCTCCAGCCCAGGCCTGGTCAGG - Intronic
1180564663 22:16652585-16652607 CCTGGAGCCCCAGCCTGACAGGG - Intergenic
1180655752 22:17419161-17419183 CCTGAAGCCCCCGCGGGGTCAGG + Intronic
1180917663 22:19500025-19500047 CCTGGAGCTACGGCCTGGACAGG + Intronic
1180972652 22:19823373-19823395 CCTGAAGACGCAGCCAGGCCGGG + Intronic
1181433701 22:22898167-22898189 CCTGCAGCTCCTGCCTTGCCAGG - Intergenic
1181434644 22:22903542-22903564 CCTGCAGCTCCTGCCTTGCCGGG - Intergenic
1181436241 22:22912824-22912846 CCTGCAGCTCCTGCCTTGCCAGG - Intergenic
1182273913 22:29172609-29172631 CCTCAAGCTGCGACCTGGCCTGG + Intergenic
1182455567 22:30448143-30448165 CCTGCAGCCCAGGCCTGGGGTGG - Intronic
1182482012 22:30615231-30615253 CCTCAAGCCCCTGCCTGTCCTGG + Intronic
1182762143 22:32731286-32731308 CCTGAATCCCAGTCCTGGCATGG - Intronic
1183242472 22:36668229-36668251 CCTGAAGCTCTGGCTTGTCCTGG - Intronic
1184219786 22:43092401-43092423 CCTGAAGGGCTGCCCTGGCCAGG - Intergenic
1184533452 22:45071161-45071183 CCTGATGCCCAGGCCAGGTCGGG + Intergenic
1184685644 22:46095460-46095482 CCTGCCGCCCCGGGCTGGCTGGG - Intronic
1184729372 22:46364486-46364508 ACTGCAGCCCCGGCCTCCCCAGG + Intronic
1185038077 22:48489940-48489962 CCTGACTCCCCGGCAGGGCCCGG + Intronic
1185038080 22:48489948-48489970 CCTGGAGCCCGGGCCCTGCCGGG - Intronic
1185130512 22:49036059-49036081 CCTGAAGCTGCAGCCAGGCCCGG + Intergenic
1185179326 22:49350127-49350149 CCTGGTGCCCCTGCGTGGCCTGG - Intergenic
1185322323 22:50207507-50207529 CTTGCAGCCCCGTCCTGCCCGGG + Intronic
1185338161 22:50279971-50279993 CCTCAAGCCCCAGCCAGGCTGGG + Intronic
1185367826 22:50445114-50445136 CCCAAAGCCCCGGCCCGGCCAGG + Exonic
953711255 3:45273044-45273066 CCTGAAGCCCAGGGCTGGAGTGG - Intergenic
953738083 3:45513401-45513423 CCTGAAGCCTGGTCCTGGACTGG + Intronic
953743333 3:45555337-45555359 GCAGAAGCCCCACCCTGGCCTGG + Intergenic
953920737 3:46949540-46949562 CCTGCAGCCCTGGACTGGGCAGG + Intronic
954003908 3:47577980-47578002 CCTGGAGCCCCGGCCCGCCCCGG + Intronic
954423644 3:50432044-50432066 CCTGCAGCCCAGCCATGGCCTGG - Intronic
954752739 3:52822900-52822922 CCAGGAGCCCCAGCCTGGCCTGG - Intronic
955392135 3:58529688-58529710 TCTGAAGCCCAGGCCAGGCGAGG + Intronic
958822507 3:98991729-98991751 CTTGAAGCTCCTGCCTGACCTGG + Intergenic
961081518 3:124032914-124032936 CCTGCAGCCCCGGGCTCGCCCGG + Intergenic
961206924 3:125091442-125091464 GGTGAAGCCCTGGACTGGCCCGG + Exonic
961358159 3:126351840-126351862 CCTCCAGCCGCAGCCTGGCCAGG + Exonic
961365883 3:126398944-126398966 CCTGCAGCCCTGGCCAGGCCAGG + Intronic
962396114 3:135016651-135016673 CCTAAAGACCCACCCTGGCCAGG + Intronic
963054993 3:141179091-141179113 CCTGGAACCCTGGCCTGGCCAGG - Intergenic
963121205 3:141778392-141778414 CCTGCAGCCCGGGCAGGGCCAGG - Exonic
963804251 3:149707333-149707355 CCAAAAACCCAGGCCTGGCCTGG - Intronic
965590358 3:170356806-170356828 CCGGCGGCCCCGGCCTCGCCCGG - Intergenic
965622737 3:170656884-170656906 CCTGAAACCCAGGCCTCCCCTGG - Intronic
965962069 3:174440971-174440993 GCTGAAAATCCGGCCTGGCCCGG + Intronic
966912875 3:184569163-184569185 GCTGGAGCCCCGGCCTGCTCCGG + Intronic
967334673 3:188330578-188330600 CCTCAATCCTAGGCCTGGCCAGG + Intronic
967844374 3:194032489-194032511 CCTGGCGCCCTGGGCTGGCCTGG + Intergenic
967977016 3:195041157-195041179 CCTTAGGCCAAGGCCTGGCCGGG - Intergenic
968085663 3:195872866-195872888 ACTGGGGCCCCGGCCTTGCCAGG - Intronic
968321214 3:197770620-197770642 CCTGGAGCCTTGGCCTGCCCTGG + Intronic
968446511 4:654991-655013 TCAGCAGCACCGGCCTGGCCTGG + Intronic
968578332 4:1378158-1378180 CGGGAAGCCAGGGCCTGGCCAGG + Intronic
968601938 4:1513586-1513608 CCGGAAGCCCGGGCCCTGCCGGG - Intergenic
968656847 4:1782403-1782425 CCTGCAGCCCCGGGCTGGACTGG + Intergenic
968884744 4:3321751-3321773 TCTGAGGCCCAGGCCTGGGCAGG + Intronic
968916503 4:3499183-3499205 CCTGAAACACCTGCCTGTCCAGG - Intronic
969695923 4:8734833-8734855 CAGGCAGCCCTGGCCTGGCCAGG - Intergenic
970449839 4:16155952-16155974 CAGGAACCCCCAGCCTGGCCTGG - Intergenic
972361188 4:38326905-38326927 CCTGTAGCCACTGCCTGGCAAGG + Intergenic
979201845 4:117987927-117987949 CCTGAAGCCCCGGCCAGGGGAGG - Intergenic
981171959 4:141636240-141636262 CCTGGAGACCCGGGCTGGGCTGG - Intergenic
984852835 4:184168847-184168869 CCTGGAGCCGGGGCCTTGCCTGG + Intronic
986721343 5:10563580-10563602 CCTCAAGCCACGGCCGGCCCCGG + Intergenic
988583541 5:32489500-32489522 AATCAAGCCCCGGCCAGGCCCGG - Intergenic
992763728 5:79975135-79975157 CCTGAAGCCCTTGACTGGTCAGG + Intergenic
995433759 5:112112348-112112370 GCTGAAGTCCAGGCATGGCCAGG + Intergenic
995805900 5:116052020-116052042 CCTGAAGGGCTGCCCTGGCCAGG + Intronic
996818254 5:127597114-127597136 CCTGCAGCTCCTACCTGGCCAGG - Intergenic
998015240 5:138726388-138726410 CCTCAGGCACAGGCCTGGCCAGG - Intronic
1001293845 5:170485270-170485292 CCAGAGGCCCAGGCCAGGCCAGG - Intronic
1002198305 5:177512978-177513000 ACTCTGGCCCCGGCCTGGCCTGG + Intronic
1002721030 5:181261553-181261575 CCGGAAGCCCCGCCCGGGCCGGG + Intergenic
1002785042 6:393606-393628 GCTGAAGGCCCGGCCGGGCCCGG + Intronic
1003324848 6:5084330-5084352 CCTGCTGCTCCGGCCTTGCCAGG - Intergenic
1003587722 6:7408325-7408347 CCTGAAGACCTGGCCAGGCAAGG - Intronic
1005780483 6:29186716-29186738 CCTGAAGCCTGGAACTGGCCTGG + Intergenic
1005841748 6:29748475-29748497 CCTGAAGCCCTGTCCTCTCCCGG - Intergenic
1006081851 6:31572413-31572435 CCTGGATCCCCGGCCTGCCTGGG + Intronic
1006169983 6:32087111-32087133 CCTGGAGCCCCGGCCAGGTAGGG + Intronic
1007304050 6:40890687-40890709 CCTGAAGCCCCTCCCTGCTCTGG + Intergenic
1012862088 6:104572123-104572145 TTTGAAGCCTGGGCCTGGCCAGG - Intergenic
1013232182 6:108168785-108168807 GCTGCAGCCCCCGCCTTGCCCGG + Intronic
1015164815 6:130192067-130192089 TCTGAATCCCCCACCTGGCCTGG + Intronic
1017699994 6:157059723-157059745 TCTAAAGCTCCTGCCTGGCCTGG + Intronic
1018391685 6:163346017-163346039 CCAGAAGCCCTGGCCTCGCTGGG + Intergenic
1018635436 6:165855410-165855432 CCTGCAGCCCCGGCCATGTCTGG - Intronic
1018865812 6:167746286-167746308 CGTGAAGCCCAGCTCTGGCCGGG - Intergenic
1019294483 7:266652-266674 CCAGAAGCCTCTGCCTGCCCAGG + Intergenic
1019331690 7:463563-463585 CCTGGAGCCCCCACTTGGCCGGG - Intergenic
1019605376 7:1907495-1907517 CCTGAGGCCCAGGCCAAGCCAGG + Intronic
1019666339 7:2253914-2253936 CCTGACGCCCCTCCCTGGCCGGG - Exonic
1021486084 7:21169856-21169878 CCCGGAGCCCCGGCCTGGCTCGG + Intergenic
1022097955 7:27152472-27152494 AGGGAAGCCCCGGCCAGGCCAGG - Intronic
1022243705 7:28536552-28536574 CCACAAGCCCCAGGCTGGCCAGG - Intronic
1022415554 7:30173792-30173814 CCTGAAGACCCAGCCTCCCCTGG + Intergenic
1024084323 7:45881098-45881120 CCTGAAGCCCATGCATGGTCCGG + Intergenic
1025078369 7:55962763-55962785 TCTGCAGCCCCGCACTGGCCTGG + Intronic
1025840404 7:65141273-65141295 GCTGCAGCCCCGGGCTGGCCGGG - Intergenic
1025878310 7:65508891-65508913 GCTGCAGCCCCGGGCTGGCCGGG + Intergenic
1025882653 7:65554691-65554713 GCTGCAGCCCCGGGCTGGCCGGG + Intergenic
1025890790 7:65647912-65647934 GCTGCAGCCCCGGGCTGGCCGGG - Exonic
1026522737 7:71131483-71131505 CCAGAAGCCCCCGCCCTGCCCGG + Intergenic
1029130134 7:98323602-98323624 CCTGGTGCTCTGGCCTGGCCGGG + Intronic
1029268970 7:99365065-99365087 TCTGAAGCCCAGGGCTGCCCTGG - Intronic
1030259008 7:107543507-107543529 CCTGAAGCCGAGGGCTGGTCTGG - Intronic
1032127400 7:129205068-129205090 CCTGAATCCCAGGGCTGGCTTGG - Intronic
1032756017 7:134891555-134891577 CCTGACCGCCCGGCCTGGCCAGG + Intronic
1033127827 7:138720461-138720483 CCTCAAGTCCTGGCCTGTCCAGG - Intronic
1033246530 7:139721078-139721100 CCTCAGACTCCGGCCTGGCCTGG + Intronic
1033407840 7:141088027-141088049 CCTTCAGCCCAGGCCTGTCCAGG - Intronic
1035380123 7:158432707-158432729 CCTGAAGACGCAGCCTGGCCCGG + Intronic
1035390441 7:158500890-158500912 CCAGCAGCACCGGCCTTGCCTGG - Intronic
1035456487 7:159012846-159012868 CCTGGAGCCCCAGCGGGGCCGGG - Intergenic
1035628763 8:1092720-1092742 CCTGAGGTCCCGACTTGGCCTGG + Intergenic
1036434654 8:8722788-8722810 CCAGGAGCACCTGCCTGGCCAGG + Intergenic
1037666334 8:20973219-20973241 CTTGCAGCACCGGCCTGGGCCGG + Intergenic
1037835694 8:22213651-22213673 GCTGAAGCCCCTGCCTGGACAGG - Intergenic
1037899853 8:22681566-22681588 CCTGCAGCCCAGGGCTGGCCTGG + Intergenic
1037967827 8:23147391-23147413 CCAAAAGCCCCGGCCTTGCTGGG + Intronic
1038506592 8:28090220-28090242 CCTGAAGCTTCGGCTGGGCCTGG - Intronic
1039846305 8:41328151-41328173 CCAGCTGCCCCGCCCTGGCCTGG + Intergenic
1045331884 8:101162306-101162328 CCAGAAACCCTGTCCTGGCCGGG - Intergenic
1047914879 8:129572357-129572379 ACTGAGGCCCAGGCCTGGCACGG + Intergenic
1048551429 8:135436908-135436930 CCTGCAGGCCCTTCCTGGCCTGG - Intergenic
1049194532 8:141308140-141308162 CCCGTAGCCCCTGCCCGGCCCGG - Intronic
1049341326 8:142114123-142114145 CCTCAGCCCCCGGCCCGGCCAGG - Intergenic
1049397056 8:142405764-142405786 CCTGCAGCCCCTGCCTGGACAGG + Intergenic
1049414758 8:142490090-142490112 CCTACAGCCCTGGCCTGGGCTGG - Intronic
1049475124 8:142793786-142793808 CCTGGAAGCCTGGCCTGGCCCGG - Intergenic
1049610597 8:143553129-143553151 CCTGAAGTCCCGCCCTGCGCGGG + Intergenic
1049655729 8:143796135-143796157 CCAGAAGCCCCTGCCTGTCCTGG - Intronic
1049711280 8:144064466-144064488 CCTGTAGCCCTGGCCTGCCCTGG - Intergenic
1049788402 8:144462236-144462258 GCTGCAGCCCCGGGCTGGGCCGG + Intronic
1049794152 8:144488906-144488928 TCAGAAGCCCCCTCCTGGCCTGG + Intronic
1050028198 9:1357344-1357366 ACTGTAGCCCCGCCCTGGCAGGG - Intergenic
1053066285 9:35071890-35071912 CCCGAGGCCCCAGCCGGGCCCGG - Intronic
1053121114 9:35548103-35548125 CCTGCAGCCATGGCCGGGCCTGG + Exonic
1053149150 9:35732042-35732064 CCTAAGGCCCCCGCCCGGCCCGG + Intronic
1053745190 9:41189343-41189365 CGTCAGGCCCCGGCCAGGCCGGG - Exonic
1054482082 9:65675870-65675892 CGTCAGGCCCCGGCCAGGCCGGG + Intronic
1054683157 9:68241925-68241947 CGTCAGGCCCCGGCCAGGCCGGG + Exonic
1056532173 9:87497740-87497762 CCCGCAGCGCCGGCCTGGCAGGG + Intronic
1057787179 9:98096026-98096048 TCTGAAGCTCTGTCCTGGCCAGG + Intronic
1060432728 9:123564398-123564420 ACTAAAGCCCTAGCCTGGCCTGG + Intronic
1060849356 9:126861155-126861177 CCTGGAGAGCCGGCCGGGCCAGG + Intronic
1060971157 9:127738895-127738917 CCAGGAGCTCCGGCCGGGCCTGG + Exonic
1061118384 9:128628592-128628614 CCTGGGGCCTCTGCCTGGCCGGG + Intronic
1061537323 9:131258261-131258283 CCTCCAGCCCCGCCCTGGCGTGG - Exonic
1061868178 9:133506174-133506196 GCAGAAGCCCTGGCCAGGCCCGG + Intergenic
1062104991 9:134750480-134750502 GCTGCAGCCCAGCCCTGGCCTGG + Intronic
1062162137 9:135086686-135086708 CCTGAAGCGCAGGCCTGACTGGG - Intronic
1062186802 9:135222537-135222559 CCGGAAGCCCCTGCTAGGCCAGG - Intergenic
1062321672 9:135993265-135993287 CCTAAATCCCCAGCCTGTCCTGG - Intergenic
1062400553 9:136370781-136370803 CCTGCAGACCCCGCCAGGCCAGG + Intronic
1062656743 9:137607504-137607526 CCTGAACCCCAGCCCTGGACTGG - Intronic
1062699459 9:137891383-137891405 CCTGGAGCCCGAGCCTGGACCGG - Intronic
1202781318 9_KI270718v1_random:127-149 CGTCAGGCCCCGGCCAGGCCGGG - Intergenic
1185786860 X:2898239-2898261 CCTGAAGCCCCTCCCAGGCCCGG + Intergenic
1187275782 X:17815651-17815673 CCTGAAGCCCAGGGCTGGTGAGG + Intronic
1191934918 X:66417067-66417089 CCTGAAGGCCCTGCATGGACTGG + Intergenic
1192266657 X:69543391-69543413 CCTCAAGCCAGGGCCTGGGCCGG + Intergenic
1196167965 X:112555824-112555846 CATGAAGCCCCTGCCTGGTGAGG - Intergenic
1197082979 X:122440974-122440996 CCTGAAGCCTCTGGCTGGCCTGG + Intergenic
1197199029 X:123732898-123732920 GCTGACGCCCTGGCCCGGCCCGG + Intronic
1197373199 X:125649754-125649776 CCTGAGGCCCAGTCCAGGCCTGG + Intergenic
1199169343 X:144717864-144717886 CATGAACCCCAGTCCTGGCCAGG - Intergenic
1199976599 X:152898128-152898150 CCTGCCTCCCCGGCCCGGCCCGG + Intergenic
1199982296 X:152927775-152927797 CCTGAGCCCCAGGCCTGCCCTGG - Intronic
1201287539 Y:12391967-12391989 CCTGAAGCCCCTCCCAGGCCCGG - Intergenic
1202601074 Y:26593541-26593563 CCTGGAGCCCCAGCCTGACAGGG - Intergenic