ID: 1153999931

View in Genome Browser
Species Human (GRCh38)
Location 18:10474317-10474339
Sequence GCGGGTTGCGGGGATGCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 137}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1153999931_1153999941 2 Left 1153999931 18:10474317-10474339 CCAGGAGCATCCCCGCAACCCGC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1153999941 18:10474342-10474364 TTCCCTCGGGGCCTTTGTGAAGG 0: 1
1: 0
2: 0
3: 9
4: 126
1153999931_1153999945 15 Left 1153999931 18:10474317-10474339 CCAGGAGCATCCCCGCAACCCGC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1153999945 18:10474355-10474377 TTTGTGAAGGTCTGCTGAATAGG 0: 1
1: 0
2: 1
3: 16
4: 166
1153999931_1153999937 -10 Left 1153999931 18:10474317-10474339 CCAGGAGCATCCCCGCAACCCGC 0: 1
1: 0
2: 0
3: 5
4: 137
Right 1153999937 18:10474330-10474352 CGCAACCCGCCGTTCCCTCGGGG 0: 1
1: 0
2: 0
3: 2
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1153999931 Original CRISPR GCGGGTTGCGGGGATGCTCC TGG (reversed) Intronic
900418894 1:2547117-2547139 GCGGGAGGTGGGGATGCGCCCGG + Intergenic
903986782 1:27234622-27234644 GCGCGTTGCTGGGCTTCTCCTGG + Exonic
905024309 1:34839395-34839417 GGGGTTTGCAGGGATGGTCCCGG - Intronic
906220121 1:44071897-44071919 GGGGGTGGAGGGGAAGCTCCAGG - Intergenic
910951612 1:92654002-92654024 GGGGGTGGCAGGGAAGCTCCTGG - Intronic
911275358 1:95852986-95853008 GCTGGGTGAGGGGATGCTCCAGG + Intergenic
911333505 1:96553141-96553163 GCAGGTTGCGGGGAAGATCATGG - Intergenic
912818668 1:112849951-112849973 GCAGGTGGCGGCGACGCTCCCGG - Intergenic
914702824 1:150149959-150149981 GCGGGTGGCGGGGGTGCGCTCGG + Exonic
920139320 1:203796125-203796147 TCGGTTTTCGGGGCTGCTCCGGG - Intronic
920499623 1:206477949-206477971 GCAGGTTCCGGGCATGCTGCAGG + Intronic
920666200 1:207964273-207964295 GAGGGTGGCGGGGTTGCTCGGGG + Intergenic
1063994965 10:11611166-11611188 GCGGGGTGCGGGGAGGCCCGGGG - Intronic
1072067838 10:91887507-91887529 GCGCGATGCTGCGATGCTCCGGG - Intergenic
1073111340 10:101064670-101064692 GGGGGTTGGGGGGATGGTGCTGG + Intronic
1076803596 10:132844184-132844206 GGGTGCTGCGGGGCTGCTCCTGG + Intronic
1080578502 11:33622315-33622337 GCGGGTTGAAGGAATGTTCCTGG + Intronic
1089403791 11:118180950-118180972 GTGGGTTGTGGGGAAGTTCCGGG - Intergenic
1090919190 11:131193215-131193237 GCGGGTTGGTGGAACGCTCCAGG - Intergenic
1091744362 12:2981785-2981807 GAGGGTAGTGGGGATGCACCTGG + Intronic
1094199120 12:27779790-27779812 GGGGGCTGCAGTGATGCTCCGGG - Intergenic
1094719104 12:33044258-33044280 GGGGGTTGGGGGGATGCTTTTGG + Intergenic
1097165908 12:57086716-57086738 GCGGGCTGCGGGGGCGCTCTGGG + Intronic
1097787877 12:63780418-63780440 GAGATTTGCGGGAATGCTCCTGG + Intronic
1102009188 12:109607582-109607604 GGGGGTCGGGGGGATGTTCCAGG - Intergenic
1102387600 12:112523045-112523067 ACAGTTTTCGGGGATGCTCCAGG + Intergenic
1104939285 12:132387353-132387375 GTGGGTGGCGGGGACGGTCCGGG + Intergenic
1110146941 13:72203140-72203162 GGGGGTTGCGGGGGAGCTCTTGG - Intergenic
1110696492 13:78497122-78497144 GCTGGCTCCAGGGATGCTCCAGG - Intergenic
1113914887 13:113864140-113864162 GCGGGTTCCCGGGAGGATCCGGG + Intergenic
1115664770 14:35534538-35534560 GCGGGTGGCAGGGAAGGTCCCGG + Exonic
1116452322 14:45080448-45080470 GCGGGAAGCGGGGCTGCGCCCGG + Intergenic
1121412945 14:93760436-93760458 GTGGGTGGAGGAGATGCTCCAGG - Intronic
1124211843 15:27770498-27770520 GCGGCCTGCGGGGAGGGTCCTGG - Intronic
1125020335 15:34978780-34978802 GTGGGTTGGGGGGACGGTCCAGG - Exonic
1128841512 15:70854355-70854377 GGGGGTCGCGGGGATCCTTCCGG - Intronic
1129724100 15:77892987-77893009 GTGGGCTGCGGGGATGGCCCTGG + Intergenic
1129851522 15:78796546-78796568 GCGGGTGGCGGGGATGGTGTTGG - Intronic
1129976274 15:79824696-79824718 CCAGGTTGAGGGGATGCTCTAGG - Intergenic
1132464777 16:72450-72472 GCGGGTTCCGGGGCTGCGTCCGG - Intronic
1133242079 16:4420790-4420812 GGGGGTTGGGGGGATGCTGCTGG - Intronic
1136278225 16:29191996-29192018 TCCTGCTGCGGGGATGCTCCGGG + Intergenic
1136637804 16:31537033-31537055 GGGGGCTGCGGGGCCGCTCCTGG + Intergenic
1136666921 16:31820099-31820121 GGGGGCTGCGGCGCTGCTCCCGG - Intergenic
1137753598 16:50884423-50884445 GCGGGATGGGGGTTTGCTCCTGG + Intergenic
1138200882 16:55087513-55087535 GAGGGTTGGGGTGATGCCCCTGG - Intergenic
1138591401 16:58001249-58001271 GCGGGGTGCCGGGAGGCTGCAGG + Intronic
1142082602 16:88158030-88158052 TCCTGCTGCGGGGATGCTCCGGG + Intergenic
1142377967 16:89716681-89716703 GCGGGCTTGGGGGATGCCCCAGG + Intronic
1143353274 17:6305665-6305687 ACGTGTTGCGGGACTGCTCCTGG - Intergenic
1143583894 17:7841969-7841991 GCGGGTTGCGACGAGGGTCCTGG + Intronic
1146213226 17:30958032-30958054 GTGGGTTGCGGGGAAGGCCCAGG - Exonic
1146433703 17:32822760-32822782 GCCGGGTGCGGGGACGCCCCGGG - Intronic
1148669906 17:49402759-49402781 GCTGGATGCGGGGAGGCTCACGG + Intronic
1151453710 17:74214075-74214097 GCGAGGTGCGGGGATGCTGAGGG + Intronic
1153999931 18:10474317-10474339 GCGGGTTGCGGGGATGCTCCTGG - Intronic
1155461664 18:26090669-26090691 GCGGGGAGGGGGGATGCTCCGGG + Intronic
1157471130 18:47989769-47989791 GGAGGTGGCGGGGATGGTCCTGG + Intergenic
1158277086 18:55780370-55780392 GCGGGCTGCGCGGAGGCTGCGGG - Intergenic
1160325176 18:77939920-77939942 GCTCCTTGCTGGGATGCTCCTGG + Intergenic
1161293081 19:3506248-3506270 TCGGGTTGCGGGGGTGCGCGCGG + Intergenic
1161410043 19:4112094-4112116 GCGGGATGCTGTGATTCTCCAGG - Intronic
1161967554 19:7556767-7556789 TGGGGTTGGGGGGATGCTTCCGG + Intronic
1162443368 19:10707192-10707214 GGGGGATGGGGGGATGCTCTTGG + Intronic
1163087500 19:14992938-14992960 GGGGGCTGCGGGGATGCCTCAGG - Intronic
1163579848 19:18131857-18131879 GCGGGGGGCGGGGGTGCCCCGGG + Intronic
1165331586 19:35143383-35143405 GGGGGTTGCAGGGGGGCTCCGGG + Intronic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167529741 19:50007801-50007823 GGGGGTTGGGGGTCTGCTCCCGG + Exonic
1168527970 19:57103823-57103845 GCTGGGTGAGGGGCTGCTCCTGG - Intergenic
926244994 2:11116492-11116514 GCAGATTACAGGGATGCTCCTGG + Intergenic
926398475 2:12469834-12469856 GCGAGTGTAGGGGATGCTCCAGG + Intergenic
931428084 2:62189224-62189246 GCAGGTTGTTGGGGTGCTCCTGG + Intergenic
932625578 2:73293373-73293395 GCGGGTGGCGGGGAGGCTGGCGG + Exonic
934714829 2:96537422-96537444 GCGGGCTGCGCCGATGGTCCGGG + Intronic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
948075817 2:235164414-235164436 GGGGCTTGCTGGGCTGCTCCTGG - Intergenic
948907869 2:240988411-240988433 GGGGTTTGCGGGGTAGCTCCTGG + Intronic
1169266458 20:4170154-4170176 GCGGGGTGGGGGGGTGCTTCTGG + Intronic
1171870694 20:30522174-30522196 GTGGGTTGCAAGGATGCTGCTGG - Intergenic
1175852535 20:62101532-62101554 GGGGGATGAGGGGCTGCTCCAGG + Intergenic
1176221090 20:63969691-63969713 GCGGGGGGCGGGGGGGCTCCGGG + Intronic
1182586660 22:31347290-31347312 GCGGGCGCTGGGGATGCTCCGGG - Intergenic
1183020040 22:35019485-35019507 GGTGGGGGCGGGGATGCTCCAGG + Intergenic
1183228489 22:36566133-36566155 ATGGGGTGTGGGGATGCTCCTGG + Intronic
1183581960 22:38731577-38731599 GCGGGGTGATGGGAGGCTCCAGG - Exonic
1183737989 22:39654424-39654446 GCAGGGTGCGGGGAGCCTCCTGG + Intronic
1184521007 22:44994110-44994132 TCACGTTGCGGGGATGCCCCGGG - Intronic
1184731794 22:46374794-46374816 GCCCATTGCGGGGATGCGCCCGG + Intronic
953954504 3:47220857-47220879 GGGGGTTTGGGGGATGCTACTGG + Intergenic
957078651 3:75619691-75619713 GCGGGATGCGGGGCTGCCGCGGG + Intergenic
968233458 3:197017338-197017360 GCGGGTGGCGGGGAAGGCCCAGG + Intronic
968289016 3:197524742-197524764 GGGGGTTGGGGGGATGCTTGAGG + Intronic
968645858 4:1740162-1740184 GCGAGTTGCGGGGAAGCTGGTGG + Intronic
968654163 4:1771536-1771558 GCGAGTAGAGGGGGTGCTCCCGG - Intergenic
972715792 4:41644647-41644669 GCGGGCAGCGGGGAGGCTTCTGG + Intronic
976094902 4:81498293-81498315 GCAGGTAGGCGGGATGCTCCTGG + Intronic
976146104 4:82044140-82044162 GCGGGCTGCGGGCAGGATCCTGG - Intronic
977607150 4:98995274-98995296 GCGGGTGTCGGGGATGATCAGGG + Intergenic
983556067 4:169060202-169060224 TCTGGTTTCGGGGGTGCTCCAGG - Intergenic
991114845 5:62942761-62942783 GGGGGTGGGGTGGATGCTCCAGG + Intergenic
999588374 5:153116714-153116736 GGGGGTTGCGGGCTTTCTCCTGG + Intergenic
1002817551 6:693912-693934 GGGGGTTGGGGGGATGCTCGGGG + Intergenic
1003442311 6:6154507-6154529 CTGGGGTGCGGGGCTGCTCCTGG - Intronic
1006922263 6:37634744-37634766 GGGGGATGGGGGGATGCTGCTGG - Exonic
1010254616 6:73743686-73743708 GCGGGTTAAGCAGATGCTCCTGG - Intronic
1010701685 6:79056586-79056608 GGGGGTAGTGGGGATGCTACTGG + Intronic
1018028796 6:159826082-159826104 GGGGGTTACGAGGATGCTGCTGG + Intergenic
1019437065 7:1027924-1027946 GCCGGTTGCGGGGCCGCTCGAGG + Intronic
1019543776 7:1563110-1563132 GCAGGTTGCCTGGAGGCTCCTGG - Intergenic
1021997970 7:26199865-26199887 GCGGGGAGGGGGGGTGCTCCGGG - Intronic
1023583417 7:41705223-41705245 CTGGGGTGCGGGGAAGCTCCGGG - Intergenic
1034232916 7:149546675-149546697 GCAGGTTGAGGGGAGGTTCCTGG + Intergenic
1034468271 7:151242486-151242508 ACGGGTGGAGGGGAAGCTCCTGG - Exonic
1035973834 8:4284655-4284677 GAGTGTTGTGGGGATCCTCCAGG - Intronic
1038304090 8:26383475-26383497 GCGGGTAGCGCGGATCCCCCTGG + Intronic
1039793981 8:40896870-40896892 CAGAGCTGCGGGGATGCTCCGGG + Intronic
1053025510 9:34725466-34725488 GCAGCTTCCGGGCATGCTCCGGG + Exonic
1053037040 9:34834528-34834550 GCAGCTTCCGGGCATGCTCCGGG + Intergenic
1053299734 9:36940529-36940551 GCGGGTCCCAGGGCTGCTCCTGG - Intronic
1053503276 9:38620370-38620392 GCGGGTTGCGGGGGAGATCGCGG - Intergenic
1053503282 9:38620389-38620411 GCGGGTTGCGGGGGGGATCGCGG - Intergenic
1057229192 9:93308596-93308618 GCGGGTGGGGCGGGTGCTCCTGG + Intronic
1058973130 9:110101246-110101268 GCAGGATGTGGGGCTGCTCCTGG + Intronic
1061196696 9:129110684-129110706 GCGGGCTGCGGGAAGGCACCCGG + Exonic
1061781549 9:132999268-132999290 GGGGGCTGCAGGGATGCTGCGGG + Intergenic
1062013217 9:134277894-134277916 GCAGGTTGCGGGGAGACCCCCGG + Intergenic
1062326048 9:136013105-136013127 GTGGGCCGCGGGGGTGCTCCCGG - Intronic
1062337032 9:136075900-136075922 GAGGGCTGCGGGGCTGCTCCTGG - Intronic
1062462113 9:136666357-136666379 GGGGGCTGCGGGGCTGCTGCCGG + Intronic
1188241496 X:27798284-27798306 GGAGGTTGAGGGGATGCTTCTGG - Intergenic
1189309346 X:40008983-40009005 GCGGGGGGCGGGGACGTTCCGGG - Intergenic
1196703488 X:118696809-118696831 TTGGGTTGGGGGGATGCTGCCGG + Intergenic
1197448436 X:126580989-126581011 GCGGGGTGTGGGGATGCCCTGGG + Intergenic
1201010669 Y:9546680-9546702 GCTGGTTGCGGGGAGGAGCCAGG - Intergenic
1202272697 Y:23086111-23086133 GGGGGATCCGGGGCTGCTCCCGG - Intergenic
1202293329 Y:23334571-23334593 GGGGGATCCGGGGCTGCTCCCGG + Intergenic
1202425694 Y:24719855-24719877 GGGGGATCCGGGGCTGCTCCCGG - Intergenic
1202445095 Y:24950230-24950252 GGGGGATCCGGGGCTGCTCCCGG + Intergenic