ID: 1154006857

View in Genome Browser
Species Human (GRCh38)
Location 18:10537912-10537934
Sequence TAGGATACCCTTAACAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154006857_1154006861 11 Left 1154006857 18:10537912-10537934 CCAGTTTTGTTAAGGGTATCCTA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1154006861 18:10537946-10537968 AACTTAGCAAGGGACTGAATAGG 0: 1
1: 0
2: 0
3: 11
4: 127
1154006857_1154006859 0 Left 1154006857 18:10537912-10537934 CCAGTTTTGTTAAGGGTATCCTA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1154006859 18:10537935-10537957 ATGAATTTGTCAACTTAGCAAGG 0: 1
1: 0
2: 0
3: 11
4: 213
1154006857_1154006860 1 Left 1154006857 18:10537912-10537934 CCAGTTTTGTTAAGGGTATCCTA 0: 1
1: 0
2: 0
3: 5
4: 85
Right 1154006860 18:10537936-10537958 TGAATTTGTCAACTTAGCAAGGG 0: 1
1: 0
2: 0
3: 19
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154006857 Original CRISPR TAGGATACCCTTAACAAAAC TGG (reversed) Intronic
901345191 1:8533909-8533931 TAAGATAACTTTAATAAAACAGG - Intronic
910266962 1:85348183-85348205 TAGGATGCCCTTAACAGATGTGG + Intronic
910771647 1:90837114-90837136 TAGGTGTCCCTTAACAAGACAGG - Intergenic
913381285 1:118213467-118213489 TAGAATACCCAGAACAAAACTGG - Intergenic
916477125 1:165180384-165180406 TAGAAGACCCTAAATAAAACTGG + Intergenic
920266605 1:204728536-204728558 TAGGATACCTGTGACAAAATAGG - Intergenic
920863117 1:209727423-209727445 GAGGATACCCATAAATAAACAGG - Intronic
923317795 1:232798136-232798158 TAGGAGACGCTTACCAAAAACGG - Intergenic
1063777725 10:9283331-9283353 TAGAATAGCCTTATCACAACAGG + Intergenic
1070743279 10:78916546-78916568 AAGGATACCCTTCACAACAGAGG + Intergenic
1076089474 10:127669439-127669461 TAGGATACACTTTATAAAAGTGG - Intergenic
1080284442 11:30592397-30592419 TAAGAGATCCTTAACAAAAGTGG + Intergenic
1086189453 11:84061072-84061094 AAAGATCCCCTGAACAAAACGGG - Intronic
1087448571 11:98287454-98287476 TATGATCCACATAACAAAACTGG - Intergenic
1091832733 12:3561536-3561558 TAGGACACCCATCACAAACCGGG - Intronic
1097417626 12:59331900-59331922 TTGGATACACTAAACAAAAAAGG - Intergenic
1098749373 12:74275571-74275593 TAGGAAACCCAAAAGAAAACAGG + Intergenic
1103360008 12:120347865-120347887 CAGGATGCCCTTGGCAAAACAGG + Intronic
1104093897 12:125538702-125538724 TAGTAAACCCTTTACAAATCAGG - Intronic
1106562443 13:30858552-30858574 TGAGATACCCTGAACCAAACAGG - Intergenic
1109872511 13:68352479-68352501 TTGGATAGCCTTCATAAAACTGG + Intergenic
1109971646 13:69778380-69778402 TAGCATACCTTTTAGAAAACTGG - Intronic
1115980981 14:39051285-39051307 TTGGATACCTTTAACATGACAGG + Intronic
1116648555 14:47561192-47561214 TAGGATTGCCTTAACTAATCTGG + Intronic
1117515356 14:56495210-56495232 TAGGATTCCATTAACAAGAAGGG + Intronic
1120103272 14:80467829-80467851 TATGATTCCCTTAGCAGAACAGG + Intergenic
1126618198 15:50608218-50608240 TTTGATACTCTTTACAAAACAGG + Intronic
1127882377 15:63169681-63169703 TGGCATACCCAGAACAAAACAGG - Intergenic
1127936078 15:63640027-63640049 AAGGATACCCTTAAGAGAAATGG - Intronic
1131506719 15:93026150-93026172 TTGGATACTCTTAACAATACTGG - Exonic
1144010058 17:11139029-11139051 TAGGATGCTCTTTACAAAATGGG + Intergenic
1153369944 18:4303940-4303962 TAGGATAACATTGACAAAAAAGG + Intronic
1154006857 18:10537912-10537934 TAGGATACCCTTAACAAAACTGG - Intronic
1164909969 19:32001636-32001658 TATCATACCCTTATCAAAAGTGG - Intergenic
927685396 2:25167496-25167518 TCGGATGCCCTCAACAGAACCGG - Intronic
932773870 2:74515666-74515688 TAGGCCACCCCTACCAAAACCGG + Exonic
941931261 2:170942140-170942162 TAGCAGACACTAAACAAAACAGG - Intronic
943435832 2:187865502-187865524 TAGGAGACCCTTATCAATTCTGG + Intergenic
944978948 2:205091928-205091950 TAGCAAACCCATAGCAAAACAGG - Intronic
1171021169 20:21585349-21585371 AAGAATACACTTAACAAAAATGG + Intergenic
1171562782 20:26141360-26141382 TAGTATACCCCTAACAAAAACGG - Intergenic
1172257804 20:33535313-33535335 TGGGATTCCCTTACAAAAACTGG + Intronic
1173088375 20:39946832-39946854 TGTCATACCCATAACAAAACTGG + Intergenic
1176021630 20:62965203-62965225 TGGGAGACCCTGAACAAAGCAGG - Intronic
1176361908 21:6004722-6004744 TAATAAACCCTCAACAAAACAGG - Intergenic
1179761610 21:43533823-43533845 TAATAAACCCTCAACAAAACAGG + Intronic
1181109512 22:20593131-20593153 TAGGAAACCCTAAAGACAACAGG + Intergenic
950079592 3:10211653-10211675 TAGGATTTATTTAACAAAACTGG - Intronic
956108538 3:65847302-65847324 CAGGATACCCTTAACAATTTGGG - Intronic
959852593 3:111107443-111107465 TAGGAAAACCATAATAAAACAGG - Intronic
961030649 3:123600522-123600544 TAGTATACCCAAAACCAAACAGG - Intergenic
966340255 3:178917792-178917814 TAGAAAACCCTCAACAAATCAGG + Intergenic
970627277 4:17901208-17901230 CAGAATACCATAAACAAAACAGG + Intronic
972959235 4:44431730-44431752 TTGGATTTTCTTAACAAAACTGG + Intronic
973368998 4:49230162-49230184 TAGGTCACCCTTAAGAACACAGG + Intergenic
973392044 4:49565253-49565275 TAGGTCACCCTTAAGAACACAGG - Intergenic
978340213 4:107714494-107714516 TAGCATACCAGTAACAAGACAGG - Intronic
985418921 4:189764040-189764062 TAAGAAACCCTTCAGAAAACTGG + Intergenic
986260417 5:6140765-6140787 TAGGACACCCAGAAGAAAACAGG + Intergenic
987687240 5:21220321-21220343 TAAGATAATCTTAAAAAAACAGG + Intergenic
988295404 5:29353871-29353893 TAAAATTCCCTTAAGAAAACTGG + Intergenic
989409957 5:41108337-41108359 AAGGATATCATTACCAAAACAGG - Intergenic
992585434 5:78233899-78233921 TAAGGTACCCCTAACAAAAGAGG + Intronic
993116762 5:83728395-83728417 AAAGAAACCCTTAACAAAATTGG + Intergenic
995571945 5:113489945-113489967 TTGGAGACCCTGAGCAAAACTGG + Intergenic
1000673814 5:164095576-164095598 TAGGATACTCCTAATACAACAGG + Intergenic
1000860743 5:166453215-166453237 AAGGATACCCTTAAGAAAAATGG - Intergenic
1003409280 6:5849244-5849266 GAGGACACCCTTATCAAATCAGG + Intergenic
1012983360 6:105852753-105852775 TGGGATTCCCTTACAAAAACTGG + Intergenic
1018724672 6:166602664-166602686 TAGGATACACACAATAAAACAGG + Intronic
1020526329 7:9263631-9263653 TAGTATATACATAACAAAACTGG - Intergenic
1028634081 7:92967578-92967600 TAGGAGATTCTTAGCAAAACAGG + Intergenic
1028707365 7:93865391-93865413 TAGGAAACCCTGGAGAAAACTGG + Intronic
1029931088 7:104371748-104371770 TAGGATACTTTTAACAATATAGG + Intronic
1030902612 7:115143086-115143108 TAGCATACGCTCCACAAAACAGG - Intergenic
1039755310 8:40516507-40516529 TAAGATACCATGAACAAAATGGG + Intergenic
1041811671 8:61918015-61918037 TAAGATGCCATTAAAAAAACAGG + Intergenic
1044407342 8:91843698-91843720 TTGGATACCTTCAATAAAACTGG - Intergenic
1046849579 8:118957093-118957115 AGGGATACCATTAACAAATCAGG + Intergenic
1047469512 8:125155773-125155795 GAGGATTCCCTGAACTAAACTGG - Intronic
1048308721 8:133301662-133301684 TAAGATACACATAACAATACAGG + Intronic
1051170401 9:14314748-14314770 TAGGATACCTTTAACAAATGAGG - Intronic
1051434034 9:17011794-17011816 TAGAATACCTTTAACAAATTGGG + Intergenic
1052590252 9:30483063-30483085 TAGGATTGCCTTAGCTAAACGGG - Intergenic
1055542240 9:77323092-77323114 TAAGATTCCTTTAACAAAAGTGG + Exonic
1058958554 9:109971448-109971470 TTGGACACCCTGCACAAAACAGG - Intronic
1059482532 9:114602570-114602592 GAGTAAAGCCTTAACAAAACTGG - Intergenic
1187306486 X:18099680-18099702 TAGAAGACCCTCAACAATACTGG - Intergenic
1192817107 X:74605447-74605469 AAGAATAACATTAACAAAACAGG + Intronic
1195479593 X:105328369-105328391 TAAGCTACCCTTAACTAAAATGG - Intronic
1199435255 X:147805566-147805588 TAGGAGACCCTGAAGACAACTGG + Intergenic